Mutagenetix > Incidental Mutations

Incidental Mutation 'R5143:Fut8'

396532

Institutional Source

Beutler Lab

Gene Symbol

Fut8

Ensembl Gene

ENSMUSG00000021065

Gene Name

fucosyltransferase 8

Synonyms

alpha (1,6) fucosyltransferase

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5143 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77238125-77476338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77365209 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 111 (D111G)

Ref Sequence

ENSEMBL: ENSMUSP00000136327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062804] [ENSMUST00000171770] [ENSMUST00000177595]

Predicted Effect

probably benign
Transcript: ENSMUST00000062804
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000054530
Gene: ENSMUSG00000021065
AA Change: D111G

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
SH3	505	562	1.13e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171770
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130845
Gene: ENSMUSG00000021065
AA Change: D111G

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
SH3	505	562	1.13e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177595
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000136327
Gene: ENSMUSG00000021065
AA Change: D111G

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
SH3	505	562	1.13e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217879

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the family of fucosyltransferases. The product of this gene catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. This enzyme is distinct from other fucosyltransferases which catalyze alpha1-2, alpha1-3, and alpha1-4 fucose addition. The expression of this gene may contribute to the malignancy of cancer cells and to their invasive and metastatic capabilities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mutation of this gene results in partial postnatal lethality, growth retardation, and progressive emphysema-like changes that include enlarged alveoli, increased lung capacity and compliance, and alveolar cell apoptosis. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,739,198		probably null	Het
Abcc2	T	C	19: 43,821,661	I886T	probably benign	Het
Adrb2	T	C	18: 62,178,776	Y326C	probably damaging	Het
AF366264	A	G	8: 13,836,844	S416P	possibly damaging	Het
Aplp1	G	A	7: 30,441,123	R334C	probably damaging	Het
AY358078	T	C	14: 51,802,549	S39P	unknown	Het
Bpifb2	A	T	2: 153,878,504	D61V	probably damaging	Het
Caap1	A	T	4: 94,501,382	N238K	probably damaging	Het
Cfap54	A	G	10: 93,029,158	V726A	possibly damaging	Het
Chrna7	T	C	7: 63,106,147	Y217C	probably damaging	Het
Crocc	T	A	4: 141,041,039	T414S	probably benign	Het
Cyp2a12	A	G	7: 27,036,611	I482V	probably benign	Het
Dnah6	A	T	6: 73,181,761	F620I	possibly damaging	Het
Eogt	A	G	6: 97,125,584	L256P	probably damaging	Het
F5	A	G	1: 164,211,828	I2002M	probably damaging	Het
Foxp1	A	G	6: 98,945,532		probably null	Het
Gm17689	T	A	9: 36,581,904	N41Y	probably benign	Het
Golgb1	C	T	16: 36,898,689	A319V	probably benign	Het
Hoxd3	C	T	2: 74,746,372	R39C	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Olfr690	T	A	7: 105,329,524	I223F	probably damaging	Het
Pcdhb2	A	G	18: 37,296,732	Y586C	probably damaging	Het
Plcd1	G	A	9: 119,074,451	Q442*	probably null	Het
Plppr5	A	G	3: 117,625,903	T207A	probably benign	Het
Pomt1	C	A	2: 32,254,329	A709E	probably benign	Het
Prmt8	A	G	6: 127,732,714	M61T	probably benign	Het
Ptpn23	A	G	9: 110,385,438		probably benign	Het
Sbf2	T	A	7: 110,422,540	K493*	probably null	Het
Tmc2	A	T	2: 130,234,818	S355C	probably damaging	Het
Tonsl	A	G	15: 76,636,657	S399P	possibly damaging	Het
Ttc14	T	C	3: 33,808,901		probably benign	Het
Ttn	A	G	2: 76,738,065	S19168P	probably damaging	Het
Usp17lb	A	T	7: 104,841,478	S80T	probably damaging	Het
Vmn2r96	A	G	17: 18,583,858	I457V	possibly damaging	Het
Wdr64	G	T	1: 175,726,413	D170Y	probably damaging	Het
Zbtb42	T	C	12: 112,679,514	V41A	probably damaging	Het

Other mutations in Fut8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Fut8	APN	12	77448488	missense	probably benign
IGL00841:Fut8	APN	12	77365321	missense	probably benign
IGL01660:Fut8	APN	12	77450258	nonsense	probably null
IGL02330:Fut8	APN	12	77450243	missense	probably damaging	1.00
IGL02815:Fut8	APN	12	77365083	missense	probably benign
IGL02836:Fut8	APN	12	77450213	missense	probably benign	0.24
IGL02981:Fut8	APN	12	77475038	missense	probably damaging	1.00
IGL03328:Fut8	APN	12	77365229	missense	probably damaging	0.99
Seaweed	UTSW	12	77475315	makesense	probably null
R0001:Fut8	UTSW	12	77475315	makesense	probably null
R0037:Fut8	UTSW	12	77365037	missense	probably benign
R0115:Fut8	UTSW	12	77448560	missense	probably damaging	1.00
R0334:Fut8	UTSW	12	77393762	missense	possibly damaging	0.95
R0481:Fut8	UTSW	12	77448560	missense	probably damaging	1.00
R0554:Fut8	UTSW	12	77364970	missense	probably benign	0.00
R0671:Fut8	UTSW	12	77475017	missense	probably damaging	1.00
R1491:Fut8	UTSW	12	77448674	missense	possibly damaging	0.50
R1918:Fut8	UTSW	12	77332218	missense	probably benign	0.25
R2336:Fut8	UTSW	12	77412956	splice site	probably benign
R2975:Fut8	UTSW	12	77365013	missense	probably benign	0.20
R3933:Fut8	UTSW	12	77475259	missense	probably damaging	1.00
R4066:Fut8	UTSW	12	77464061	missense	probably damaging	1.00
R4067:Fut8	UTSW	12	77464061	missense	probably damaging	1.00
R4159:Fut8	UTSW	12	77393749	missense	probably damaging	0.98
R4728:Fut8	UTSW	12	77475199	missense	probably damaging	1.00
R4768:Fut8	UTSW	12	77365280	missense	probably benign	0.12
R4831:Fut8	UTSW	12	77393829	missense	probably damaging	0.99
R4914:Fut8	UTSW	12	77475044	missense	probably damaging	1.00
R4915:Fut8	UTSW	12	77475044	missense	probably damaging	1.00
R4917:Fut8	UTSW	12	77475044	missense	probably damaging	1.00
R4918:Fut8	UTSW	12	77475044	missense	probably damaging	1.00
R5234:Fut8	UTSW	12	77332230	missense	probably benign	0.12
R5973:Fut8	UTSW	12	77364997	missense	probably benign
R6103:Fut8	UTSW	12	77331947	start gained	probably benign
R7167:Fut8	UTSW	12	77448632	missense	possibly damaging	0.94
R7498:Fut8	UTSW	12	77412934	missense	probably benign	0.00
R7536:Fut8	UTSW	12	77475078	missense	probably damaging	1.00
X0065:Fut8	UTSW	12	77448521	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATACCAGAAGGCCCCATTG -3'
(R):5'- GCATGTAGGGGCATACTACC -3'

Sequencing Primer
(F):5'- GTCCGTGTTTTAGAAGAACAGC -3'
(R):5'- AGGGGCATACTACCTTTCATG -3'

Posted On

2016-06-21