Incidental Mutation 'R5143:Fut8'
ID396532
Institutional Source Beutler Lab
Gene Symbol Fut8
Ensembl Gene ENSMUSG00000021065
Gene Namefucosyltransferase 8
Synonymsalpha (1,6) fucosyltransferase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location77238125-77476338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77365209 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000136327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062804] [ENSMUST00000171770] [ENSMUST00000177595]
Predicted Effect probably benign
Transcript: ENSMUST00000062804
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054530
Gene: ENSMUSG00000021065
AA Change: D111G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171770
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130845
Gene: ENSMUSG00000021065
AA Change: D111G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177595
AA Change: D111G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136327
Gene: ENSMUSG00000021065
AA Change: D111G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SH3 505 562 1.13e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217879
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the family of fucosyltransferases. The product of this gene catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. This enzyme is distinct from other fucosyltransferases which catalyze alpha1-2, alpha1-3, and alpha1-4 fucose addition. The expression of this gene may contribute to the malignancy of cancer cells and to their invasive and metastatic capabilities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mutation of this gene results in partial postnatal lethality, growth retardation, and progressive emphysema-like changes that include enlarged alveoli, increased lung capacity and compliance, and alveolar cell apoptosis. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Fut8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Fut8 APN 12 77448488 missense probably benign
IGL00841:Fut8 APN 12 77365321 missense probably benign
IGL01660:Fut8 APN 12 77450258 nonsense probably null
IGL02330:Fut8 APN 12 77450243 missense probably damaging 1.00
IGL02815:Fut8 APN 12 77365083 missense probably benign
IGL02836:Fut8 APN 12 77450213 missense probably benign 0.24
IGL02981:Fut8 APN 12 77475038 missense probably damaging 1.00
IGL03328:Fut8 APN 12 77365229 missense probably damaging 0.99
Seaweed UTSW 12 77475315 makesense probably null
R0001:Fut8 UTSW 12 77475315 makesense probably null
R0037:Fut8 UTSW 12 77365037 missense probably benign
R0115:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0334:Fut8 UTSW 12 77393762 missense possibly damaging 0.95
R0481:Fut8 UTSW 12 77448560 missense probably damaging 1.00
R0554:Fut8 UTSW 12 77364970 missense probably benign 0.00
R0671:Fut8 UTSW 12 77475017 missense probably damaging 1.00
R1491:Fut8 UTSW 12 77448674 missense possibly damaging 0.50
R1918:Fut8 UTSW 12 77332218 missense probably benign 0.25
R2336:Fut8 UTSW 12 77412956 splice site probably benign
R2975:Fut8 UTSW 12 77365013 missense probably benign 0.20
R3933:Fut8 UTSW 12 77475259 missense probably damaging 1.00
R4066:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4067:Fut8 UTSW 12 77464061 missense probably damaging 1.00
R4159:Fut8 UTSW 12 77393749 missense probably damaging 0.98
R4728:Fut8 UTSW 12 77475199 missense probably damaging 1.00
R4768:Fut8 UTSW 12 77365280 missense probably benign 0.12
R4831:Fut8 UTSW 12 77393829 missense probably damaging 0.99
R4914:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4915:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4917:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R4918:Fut8 UTSW 12 77475044 missense probably damaging 1.00
R5234:Fut8 UTSW 12 77332230 missense probably benign 0.12
R5973:Fut8 UTSW 12 77364997 missense probably benign
R6103:Fut8 UTSW 12 77331947 start gained probably benign
R7167:Fut8 UTSW 12 77448632 missense possibly damaging 0.94
R7498:Fut8 UTSW 12 77412934 missense probably benign 0.00
R7536:Fut8 UTSW 12 77475078 missense probably damaging 1.00
X0065:Fut8 UTSW 12 77448521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATACCAGAAGGCCCCATTG -3'
(R):5'- GCATGTAGGGGCATACTACC -3'

Sequencing Primer
(F):5'- GTCCGTGTTTTAGAAGAACAGC -3'
(R):5'- AGGGGCATACTACCTTTCATG -3'
Posted On2016-06-21