Incidental Mutation 'R5143:Zbtb42'
ID396533
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112679514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144550] [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably benign
Transcript: ENSMUST00000144550
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169593
AA Change: V41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: V41A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173942
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Pfam:BTB 1 40 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Other mutations in Zbtb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Zbtb42 APN 12 112680284 missense probably benign 0.35
R0607:Zbtb42 UTSW 12 112680627 missense probably benign 0.32
R4586:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4607:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4609:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4890:Zbtb42 UTSW 12 112680427 nonsense probably null
R5933:Zbtb42 UTSW 12 112680621 missense probably damaging 1.00
R6066:Zbtb42 UTSW 12 112679607 missense probably damaging 1.00
R6245:Zbtb42 UTSW 12 112679535 missense probably damaging 1.00
R6974:Zbtb42 UTSW 12 112680390 missense probably damaging 0.97
R8092:Zbtb42 UTSW 12 112679841 missense probably damaging 1.00
R8253:Zbtb42 UTSW 12 112680312 missense probably damaging 1.00
Z1176:Zbtb42 UTSW 12 112680199 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCGGCTTCTGTTTACTTTC -3'
(R):5'- GACGATGTCATACATGTGCAGG -3'

Sequencing Primer
(F):5'- GATCGAGTTTTTCCTGCTCCGG -3'
(R):5'- GGCAGCCAGGACGTCCTC -3'
Posted On2016-06-21