Incidental Mutation 'R5143:AY358078'
ID396534
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene NamecDNA sequence AY358078
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51800046-51826359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51802549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 39 (S39P)
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
Predicted Effect unknown
Transcript: ENSMUST00000053821
AA Change: S39P
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961
AA Change: S39P

DomainStartEndE-ValueType
Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 51805709 splice site probably benign
IGL02053:AY358078 APN 14 51805552 missense unknown
IGL02057:AY358078 APN 14 51820305 missense unknown
IGL02498:AY358078 APN 14 51803487 missense probably benign 0.00
FR4737:AY358078 UTSW 14 51805698 missense unknown
R0140:AY358078 UTSW 14 51825942 missense probably benign 0.12
R0466:AY358078 UTSW 14 51805632 missense unknown
R0496:AY358078 UTSW 14 51803532 missense unknown
R1546:AY358078 UTSW 14 51820419 intron probably null
R1793:AY358078 UTSW 14 51804594 missense unknown
R1867:AY358078 UTSW 14 51800047 start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1994:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1995:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R2184:AY358078 UTSW 14 51825988 missense probably damaging 1.00
R2322:AY358078 UTSW 14 51804690 missense unknown
R2441:AY358078 UTSW 14 51800089 missense probably benign 0.00
R3851:AY358078 UTSW 14 51805553 missense unknown
R3852:AY358078 UTSW 14 51805553 missense unknown
R4600:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4603:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4610:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4611:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4916:AY358078 UTSW 14 51802651 missense unknown
R5096:AY358078 UTSW 14 51826118 missense probably benign 0.19
R5609:AY358078 UTSW 14 51804608 missense unknown
R5651:AY358078 UTSW 14 51822160 missense unknown
R6345:AY358078 UTSW 14 51826292 missense probably damaging 1.00
R6988:AY358078 UTSW 14 51826187 missense probably damaging 0.99
R7340:AY358078 UTSW 14 51826259 missense probably damaging 1.00
RF002:AY358078 UTSW 14 51805593 nonsense probably null
RF017:AY358078 UTSW 14 51805593 nonsense probably null
RF025:AY358078 UTSW 14 51805589 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTTGCCATACGGTATTTCC -3'
(R):5'- ACTCTGCCCAGGACTCATTG -3'

Sequencing Primer
(F):5'- GTATTTCCCAAGTCACAGGAGATGC -3'
(R):5'- ATTGTGCCTTCCCCAGAATG -3'
Posted On2016-06-21