Incidental Mutation 'R5143:Mfng'
ID396536
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene NameMFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsmanic fringe
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78755882-78773475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78764388 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 163 (R163H)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
PDB Structure
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018313
AA Change: R163H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: R163H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136795
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R0504:Mfng UTSW 15 78757314 missense probably benign 0.00
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4925:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5067:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6012:Mfng UTSW 15 78756640 missense probably damaging 1.00
R6654:Mfng UTSW 15 78759339 missense probably damaging 1.00
R7211:Mfng UTSW 15 78773068 missense probably benign 0.12
R7793:Mfng UTSW 15 78773065 missense probably damaging 1.00
R8292:Mfng UTSW 15 78773170 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATCCATGGTGATTCTAGGTGG -3'
(R):5'- CTCCCTGACTCACAGCTATTAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGCTCTCTGATG -3'
(R):5'- CTATTAGCTGTTGACCTCGGGGAC -3'
Posted On2016-06-21