Incidental Mutation 'R5143:Adrb2'
ID396541
Institutional Source Beutler Lab
Gene Symbol Adrb2
Ensembl Gene ENSMUSG00000045730
Gene Nameadrenergic receptor, beta 2
SynonymsGpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5143 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62177817-62179959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62178776 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 326 (Y326C)
Ref Sequence ENSEMBL: ENSMUSP00000062256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]
Predicted Effect probably damaging
Transcript: ENSMUST00000053640
AA Change: Y326C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: Y326C

DomainStartEndE-ValueType
Pfam:7tm_4 40 246 4.7e-10 PFAM
Pfam:7TM_GPCR_Srx 41 250 2.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 43 340 1.4e-15 PFAM
Pfam:7tm_1 50 326 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067743
SMART Domains Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Plppr5 A G 3: 117,625,903 T207A probably benign Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Adrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Adrb2 APN 18 62179007 missense probably benign 0.00
PIT4514001:Adrb2 UTSW 18 62179727 missense probably benign 0.00
R0091:Adrb2 UTSW 18 62179019 missense probably benign
R0420:Adrb2 UTSW 18 62179539 missense possibly damaging 0.76
R0436:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R0604:Adrb2 UTSW 18 62178515 missense possibly damaging 0.49
R0626:Adrb2 UTSW 18 62179370 missense probably damaging 1.00
R0843:Adrb2 UTSW 18 62179071 missense probably benign 0.03
R0940:Adrb2 UTSW 18 62179691 missense probably benign 0.00
R1498:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R1517:Adrb2 UTSW 18 62178800 missense probably damaging 1.00
R1603:Adrb2 UTSW 18 62179508 missense probably damaging 1.00
R1944:Adrb2 UTSW 18 62179413 missense probably damaging 1.00
R4367:Adrb2 UTSW 18 62179056 missense probably damaging 1.00
R5468:Adrb2 UTSW 18 62179625 missense probably damaging 1.00
R5644:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R6073:Adrb2 UTSW 18 62179466 missense probably benign 0.01
R6753:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R7883:Adrb2 UTSW 18 62179376 missense probably damaging 0.98
R8298:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R8366:Adrb2 UTSW 18 62178704 missense probably benign 0.00
R8420:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R8427:Adrb2 UTSW 18 62179274 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAAGGCTAGGCACAGTACCTTG -3'
(R):5'- CAAAGCCCTCAAGACTTTAGGC -3'

Sequencing Primer
(F):5'- TAGGCACAGTACCTTGACAGTTC -3'
(R):5'- TTAGGCATCATCATGGGCAC -3'
Posted On2016-06-21