Mutagenetix > Incidental Mutations

Incidental Mutation 'R5143:Adrb2'

396541

Institutional Source

Beutler Lab

Gene Symbol

Adrb2

Ensembl Gene

ENSMUSG00000045730

Gene Name

adrenergic receptor, beta 2

Synonyms

Gpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5143 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62177817-62179959 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62178776 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 326 (Y326C)

Ref Sequence

ENSEMBL: ENSMUSP00000062256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053640
AA Change: Y326C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: Y326C

Domain	Start	End	E-Value	Type
Pfam:7tm_4	40	246	4.7e-10	PFAM
Pfam:7TM_GPCR_Srx	41	250	2.2e-8	PFAM
Pfam:7TM_GPCR_Srsx	43	340	1.4e-15	PFAM
Pfam:7tm_1	50	326	9.8e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000067743

SMART Domains

Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

Domain	Start	End	E-Value	Type
low complexity region	53	69	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	C	T	5: 109,739,198		probably null	Het
Abcc2	T	C	19: 43,821,661	I886T	probably benign	Het
AF366264	A	G	8: 13,836,844	S416P	possibly damaging	Het
Aplp1	G	A	7: 30,441,123	R334C	probably damaging	Het
AY358078	T	C	14: 51,802,549	S39P	unknown	Het
Bpifb2	A	T	2: 153,878,504	D61V	probably damaging	Het
Caap1	A	T	4: 94,501,382	N238K	probably damaging	Het
Cfap54	A	G	10: 93,029,158	V726A	possibly damaging	Het
Chrna7	T	C	7: 63,106,147	Y217C	probably damaging	Het
Crocc	T	A	4: 141,041,039	T414S	probably benign	Het
Cyp2a12	A	G	7: 27,036,611	I482V	probably benign	Het
Dnah6	A	T	6: 73,181,761	F620I	possibly damaging	Het
Eogt	A	G	6: 97,125,584	L256P	probably damaging	Het
F5	A	G	1: 164,211,828	I2002M	probably damaging	Het
Foxp1	A	G	6: 98,945,532		probably null	Het
Fut8	A	G	12: 77,365,209	D111G	probably benign	Het
Gm17689	T	A	9: 36,581,904	N41Y	probably benign	Het
Golgb1	C	T	16: 36,898,689	A319V	probably benign	Het
Hoxd3	C	T	2: 74,746,372	R39C	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Olfr690	T	A	7: 105,329,524	I223F	probably damaging	Het
Pcdhb2	A	G	18: 37,296,732	Y586C	probably damaging	Het
Plcd1	G	A	9: 119,074,451	Q442*	probably null	Het
Plppr5	A	G	3: 117,625,903	T207A	probably benign	Het
Pomt1	C	A	2: 32,254,329	A709E	probably benign	Het
Prmt8	A	G	6: 127,732,714	M61T	probably benign	Het
Ptpn23	A	G	9: 110,385,438		probably benign	Het
Sbf2	T	A	7: 110,422,540	K493*	probably null	Het
Tmc2	A	T	2: 130,234,818	S355C	probably damaging	Het
Tonsl	A	G	15: 76,636,657	S399P	possibly damaging	Het
Ttc14	T	C	3: 33,808,901		probably benign	Het
Ttn	A	G	2: 76,738,065	S19168P	probably damaging	Het
Usp17lb	A	T	7: 104,841,478	S80T	probably damaging	Het
Vmn2r96	A	G	17: 18,583,858	I457V	possibly damaging	Het
Wdr64	G	T	1: 175,726,413	D170Y	probably damaging	Het
Zbtb42	T	C	12: 112,679,514	V41A	probably damaging	Het

Other mutations in Adrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02336:Adrb2	APN	18	62179007	missense	probably benign	0.00
PIT4514001:Adrb2	UTSW	18	62179727	missense	probably benign	0.00
R0091:Adrb2	UTSW	18	62179019	missense	probably benign
R0420:Adrb2	UTSW	18	62179539	missense	possibly damaging	0.76
R0436:Adrb2	UTSW	18	62179553	missense	possibly damaging	0.93
R0604:Adrb2	UTSW	18	62178515	missense	possibly damaging	0.49
R0626:Adrb2	UTSW	18	62179370	missense	probably damaging	1.00
R0843:Adrb2	UTSW	18	62179071	missense	probably benign	0.03
R0940:Adrb2	UTSW	18	62179691	missense	probably benign	0.00
R1498:Adrb2	UTSW	18	62178933	missense	probably damaging	1.00
R1517:Adrb2	UTSW	18	62178800	missense	probably damaging	1.00
R1603:Adrb2	UTSW	18	62179508	missense	probably damaging	1.00
R1944:Adrb2	UTSW	18	62179413	missense	probably damaging	1.00
R4367:Adrb2	UTSW	18	62179056	missense	probably damaging	1.00
R5468:Adrb2	UTSW	18	62179625	missense	probably damaging	1.00
R5644:Adrb2	UTSW	18	62178682	missense	probably benign	0.01
R6073:Adrb2	UTSW	18	62179466	missense	probably benign	0.01
R6753:Adrb2	UTSW	18	62179553	missense	possibly damaging	0.93
R7883:Adrb2	UTSW	18	62179376	missense	probably damaging	0.98
R8298:Adrb2	UTSW	18	62178682	missense	probably benign	0.01
R8366:Adrb2	UTSW	18	62178704	missense	probably benign	0.00
R8420:Adrb2	UTSW	18	62178933	missense	probably damaging	1.00
R8427:Adrb2	UTSW	18	62179274	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TAAGGCTAGGCACAGTACCTTG -3'
(R):5'- CAAAGCCCTCAAGACTTTAGGC -3'

Sequencing Primer
(F):5'- TAGGCACAGTACCTTGACAGTTC -3'
(R):5'- TTAGGCATCATCATGGGCAC -3'

Posted On

2016-06-21