Mutagenetix > Incidental Mutation

Incidental Mutation 'R5154:Cr2'

396552

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

042736-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R5154 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195159446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 400 (W400R)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: W400R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: W400R

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: W103R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: W103R

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: W400R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: W400R

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: W776R

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	C	4: 39,450,938	H48P	probably damaging	Het
Angptl7	C	T	4: 148,497,425	R168H	probably damaging	Het
Ankrd11	A	C	8: 122,893,139	F1325V	probably damaging	Het
Ankrd13c	A	G	3: 157,988,660	D266G	possibly damaging	Het
Apold1	A	T	6: 134,983,673	H30L	possibly damaging	Het
Arel1	A	G	12: 84,931,773	F362L	probably benign	Het
Arhgef4	T	A	1: 34,732,374	M1254K	probably benign	Het
Arid2	T	A	15: 96,401,985	V1793E	probably damaging	Het
Bcl7a	T	C	5: 123,369,359	S156P	probably damaging	Het
Cbr3	A	G	16: 93,685,139	I128V	probably benign	Het
Cct6b	G	A	11: 82,739,695	P299L	probably damaging	Het
Cd180	A	T	13: 102,705,774	N443Y	probably damaging	Het
Cd80	A	G	16: 38,473,980	K75R	probably benign	Het
Cdk1	A	T	10: 69,340,468		probably benign	Het
Cep192	T	A	18: 67,850,684	F1565I	probably damaging	Het
Chtf18	T	C	17: 25,723,720	T412A	probably damaging	Het
Cit	T	C	5: 115,988,405	L1590P	probably damaging	Het
Clcn2	T	A	16: 20,703,303	R845S	probably benign	Het
Cndp2	C	T	18: 84,668,602	V432I	probably benign	Het
Cnnm2	A	T	19: 46,763,132	R454W	probably benign	Het
Cpne8	T	G	15: 90,499,918	I480L	probably benign	Het
Cul5	A	G	9: 53,625,867	L528P	probably damaging	Het
Dlgap5	C	T	14: 47,413,720	V119M	probably damaging	Het
Dnah12	T	C	14: 26,849,363	S190P	probably benign	Het
Dnah3	T	A	7: 119,952,419	K2881N	probably damaging	Het
Dnmt3a	A	T	12: 3,896,008	I288F	probably damaging	Het
Dse	T	A	10: 34,153,661	T478S	possibly damaging	Het
Edn1	C	T	13: 42,305,023	T104I	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eprs	A	G	1: 185,413,465	H1157R	probably damaging	Het
Fam168b	G	A	1: 34,818,099	T179I	possibly damaging	Het
Fzd5	A	G	1: 64,735,972	V210A	probably benign	Het
Gm9742	T	C	13: 8,035,045		noncoding transcript	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Gpr141	C	T	13: 19,752,242	R121K	probably benign	Het
Greb1l	A	G	18: 10,458,312	T30A	probably benign	Het
Grk3	A	T	5: 112,941,717	I281N	probably damaging	Het
Hnrnpdl	A	T	5: 100,036,512	Y289*	probably null	Het
Hsf2	T	G	10: 57,504,712	V214G	probably benign	Het
Igf2bp1	G	A	11: 95,963,547	Q563*	probably null	Het
Il31ra	T	A	13: 112,523,997	D605V	possibly damaging	Het
Insm2	G	A	12: 55,600,197	C242Y	probably damaging	Het
Ints3	C	T	3: 90,415,561	V121I	probably benign	Het
Kcnt2	A	T	1: 140,351,256	L48F	possibly damaging	Het
Kit	G	A	5: 75,640,540	V529M	probably damaging	Het
Mark2	G	A	19: 7,283,074	P13S	probably damaging	Het
Mthfsd	A	G	8: 121,098,740	V364A	probably damaging	Het
Mtmr11	C	G	3: 96,164,319	S185R	probably benign	Het
Myot	A	G	18: 44,354,214	I373V	probably benign	Het
N4bp3	A	T	11: 51,645,312	V231D	probably benign	Het
Olfr1089	A	T	2: 86,732,777	Y278*	probably null	Het
Olfr1102	T	C	2: 87,002,038	V23A	probably benign	Het
Pdcd6ip	A	G	9: 113,691,542	F125L	probably damaging	Het
Prpf39	A	T	12: 65,048,277	Q124L	probably benign	Het
Reln	A	T	5: 21,988,765	N1398K	probably damaging	Het
Rhod	A	T	19: 4,432,094	D97E	probably damaging	Het
Rxra	T	C	2: 27,757,868		probably null	Het
Slc1a3	T	C	15: 8,642,949	I349V	probably benign	Het
Slc37a2	A	T	9: 37,231,643	*502R	probably null	Het
Slc9b1	T	C	3: 135,373,179	I199T	probably damaging	Het
Spg20	C	T	3: 55,117,329	P115L	probably damaging	Het
Tnpo1	A	T	13: 98,870,305	C205S	possibly damaging	Het
Tubb1	T	A	2: 174,456,864	I113N	probably benign	Het
Tyrp1	G	A	4: 80,850,717	V483I	probably benign	Het
Vwde	T	C	6: 13,215,758	S100G	probably benign	Het
Zfhx3	A	T	8: 108,800,575	I1035F	probably damaging	Het
Zfp618	G	T	4: 63,133,209	K742N	probably damaging	Het
Zfp873	T	C	10: 82,060,191	V252A	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GAATTTTCCACAGAGCTTAAGAGG -3'
(R):5'- GTCAGAAGACTGGGATCTGG -3'

Sequencing Primer
(F):5'- TTAAGAGGGTGCTAAAGAAAGCCTTC -3'
(R):5'- GAGTGGCCCTGCTCCATATTG -3'

Posted On

2016-06-21