Incidental Mutation 'R5154:Igf2bp1'
ID396593
Institutional Source Beutler Lab
Gene Symbol Igf2bp1
Ensembl Gene ENSMUSG00000013415
Gene Nameinsulin-like growth factor 2 mRNA binding protein 1
SynonymsIMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp
MMRRC Submission 042736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5154 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location95957163-96005940 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95963547 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 563 (Q563*)
Ref Sequence ENSEMBL: ENSMUSP00000013559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013559]
Predicted Effect probably null
Transcript: ENSMUST00000013559
AA Change: Q563*
SMART Domains Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415
AA Change: Q563*

DomainStartEndE-ValueType
RRM 3 71 7.42e-9 SMART
RRM 82 152 5.25e-9 SMART
KH 194 265 7.75e-14 SMART
KH 275 348 7.34e-15 SMART
low complexity region 377 390 N/A INTRINSIC
KH 404 475 1.91e-13 SMART
KH 486 558 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,938 H48P probably damaging Het
Angptl7 C T 4: 148,497,425 R168H probably damaging Het
Ankrd11 A C 8: 122,893,139 F1325V probably damaging Het
Ankrd13c A G 3: 157,988,660 D266G possibly damaging Het
Apold1 A T 6: 134,983,673 H30L possibly damaging Het
Arel1 A G 12: 84,931,773 F362L probably benign Het
Arhgef4 T A 1: 34,732,374 M1254K probably benign Het
Arid2 T A 15: 96,401,985 V1793E probably damaging Het
Bcl7a T C 5: 123,369,359 S156P probably damaging Het
Cbr3 A G 16: 93,685,139 I128V probably benign Het
Cct6b G A 11: 82,739,695 P299L probably damaging Het
Cd180 A T 13: 102,705,774 N443Y probably damaging Het
Cd80 A G 16: 38,473,980 K75R probably benign Het
Cdk1 A T 10: 69,340,468 probably benign Het
Cep192 T A 18: 67,850,684 F1565I probably damaging Het
Chtf18 T C 17: 25,723,720 T412A probably damaging Het
Cit T C 5: 115,988,405 L1590P probably damaging Het
Clcn2 T A 16: 20,703,303 R845S probably benign Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Cnnm2 A T 19: 46,763,132 R454W probably benign Het
Cpne8 T G 15: 90,499,918 I480L probably benign Het
Cr2 A G 1: 195,159,446 W400R probably damaging Het
Cul5 A G 9: 53,625,867 L528P probably damaging Het
Dlgap5 C T 14: 47,413,720 V119M probably damaging Het
Dnah12 T C 14: 26,849,363 S190P probably benign Het
Dnah3 T A 7: 119,952,419 K2881N probably damaging Het
Dnmt3a A T 12: 3,896,008 I288F probably damaging Het
Dse T A 10: 34,153,661 T478S possibly damaging Het
Edn1 C T 13: 42,305,023 T104I probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eprs A G 1: 185,413,465 H1157R probably damaging Het
Fam168b G A 1: 34,818,099 T179I possibly damaging Het
Fzd5 A G 1: 64,735,972 V210A probably benign Het
Gm9742 T C 13: 8,035,045 noncoding transcript Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Gpr141 C T 13: 19,752,242 R121K probably benign Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Grk3 A T 5: 112,941,717 I281N probably damaging Het
Hnrnpdl A T 5: 100,036,512 Y289* probably null Het
Hsf2 T G 10: 57,504,712 V214G probably benign Het
Il31ra T A 13: 112,523,997 D605V possibly damaging Het
Insm2 G A 12: 55,600,197 C242Y probably damaging Het
Ints3 C T 3: 90,415,561 V121I probably benign Het
Kcnt2 A T 1: 140,351,256 L48F possibly damaging Het
Kit G A 5: 75,640,540 V529M probably damaging Het
Mark2 G A 19: 7,283,074 P13S probably damaging Het
Mthfsd A G 8: 121,098,740 V364A probably damaging Het
Mtmr11 C G 3: 96,164,319 S185R probably benign Het
Myot A G 18: 44,354,214 I373V probably benign Het
N4bp3 A T 11: 51,645,312 V231D probably benign Het
Olfr1089 A T 2: 86,732,777 Y278* probably null Het
Olfr1102 T C 2: 87,002,038 V23A probably benign Het
Pdcd6ip A G 9: 113,691,542 F125L probably damaging Het
Prpf39 A T 12: 65,048,277 Q124L probably benign Het
Reln A T 5: 21,988,765 N1398K probably damaging Het
Rhod A T 19: 4,432,094 D97E probably damaging Het
Rxra T C 2: 27,757,868 probably null Het
Slc1a3 T C 15: 8,642,949 I349V probably benign Het
Slc37a2 A T 9: 37,231,643 *502R probably null Het
Slc9b1 T C 3: 135,373,179 I199T probably damaging Het
Spg20 C T 3: 55,117,329 P115L probably damaging Het
Tnpo1 A T 13: 98,870,305 C205S possibly damaging Het
Tubb1 T A 2: 174,456,864 I113N probably benign Het
Tyrp1 G A 4: 80,850,717 V483I probably benign Het
Vwde T C 6: 13,215,758 S100G probably benign Het
Zfhx3 A T 8: 108,800,575 I1035F probably damaging Het
Zfp618 G T 4: 63,133,209 K742N probably damaging Het
Zfp873 T C 10: 82,060,191 V252A possibly damaging Het
Other mutations in Igf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Igf2bp1 APN 11 95974168 missense probably damaging 0.97
IGL03263:Igf2bp1 APN 11 95966673 missense probably damaging 1.00
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0098:Igf2bp1 UTSW 11 95973163 missense probably damaging 1.00
R0348:Igf2bp1 UTSW 11 95968893 missense possibly damaging 0.59
R0534:Igf2bp1 UTSW 11 95966796 splice site probably benign
R2025:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2026:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2103:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R2104:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R5021:Igf2bp1 UTSW 11 95974006 missense probably damaging 0.98
R6123:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R6130:Igf2bp1 UTSW 11 95974020 missense probably damaging 1.00
R6736:Igf2bp1 UTSW 11 95973122 missense probably benign 0.14
R7173:Igf2bp1 UTSW 11 95968464 missense probably benign
R7748:Igf2bp1 UTSW 11 95967587 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAAACCTGATCTCCAGCC -3'
(R):5'- AACTCTCCCTTGAATGGACGG -3'

Sequencing Primer
(F):5'- TGATCTCCAGCCAGGCC -3'
(R):5'- CCTTGAATGGACGGGCGAG -3'
Posted On2016-06-21