Mutagenetix > Incidental Mutations

Incidental Mutation 'R5154:Cd180'

396603

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

MMRRC Submission

042736-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5154 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102705774 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 443 (N443Y)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022124
AA Change: N443Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: N443Y

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167144

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171267

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	C	4: 39,450,938	H48P	probably damaging	Het
Angptl7	C	T	4: 148,497,425	R168H	probably damaging	Het
Ankrd11	A	C	8: 122,893,139	F1325V	probably damaging	Het
Ankrd13c	A	G	3: 157,988,660	D266G	possibly damaging	Het
Apold1	A	T	6: 134,983,673	H30L	possibly damaging	Het
Arel1	A	G	12: 84,931,773	F362L	probably benign	Het
Arhgef4	T	A	1: 34,732,374	M1254K	probably benign	Het
Arid2	T	A	15: 96,401,985	V1793E	probably damaging	Het
Bcl7a	T	C	5: 123,369,359	S156P	probably damaging	Het
Cbr3	A	G	16: 93,685,139	I128V	probably benign	Het
Cct6b	G	A	11: 82,739,695	P299L	probably damaging	Het
Cd80	A	G	16: 38,473,980	K75R	probably benign	Het
Cdk1	A	T	10: 69,340,468		probably benign	Het
Cep192	T	A	18: 67,850,684	F1565I	probably damaging	Het
Chtf18	T	C	17: 25,723,720	T412A	probably damaging	Het
Cit	T	C	5: 115,988,405	L1590P	probably damaging	Het
Clcn2	T	A	16: 20,703,303	R845S	probably benign	Het
Cndp2	C	T	18: 84,668,602	V432I	probably benign	Het
Cnnm2	A	T	19: 46,763,132	R454W	probably benign	Het
Cpne8	T	G	15: 90,499,918	I480L	probably benign	Het
Cr2	A	G	1: 195,159,446	W400R	probably damaging	Het
Cul5	A	G	9: 53,625,867	L528P	probably damaging	Het
Dlgap5	C	T	14: 47,413,720	V119M	probably damaging	Het
Dnah12	T	C	14: 26,849,363	S190P	probably benign	Het
Dnah3	T	A	7: 119,952,419	K2881N	probably damaging	Het
Dnmt3a	A	T	12: 3,896,008	I288F	probably damaging	Het
Dse	T	A	10: 34,153,661	T478S	possibly damaging	Het
Edn1	C	T	13: 42,305,023	T104I	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eprs	A	G	1: 185,413,465	H1157R	probably damaging	Het
Fam168b	G	A	1: 34,818,099	T179I	possibly damaging	Het
Fzd5	A	G	1: 64,735,972	V210A	probably benign	Het
Gm9742	T	C	13: 8,035,045		noncoding transcript	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Gpr141	C	T	13: 19,752,242	R121K	probably benign	Het
Greb1l	A	G	18: 10,458,312	T30A	probably benign	Het
Grk3	A	T	5: 112,941,717	I281N	probably damaging	Het
Hnrnpdl	A	T	5: 100,036,512	Y289*	probably null	Het
Hsf2	T	G	10: 57,504,712	V214G	probably benign	Het
Igf2bp1	G	A	11: 95,963,547	Q563*	probably null	Het
Il31ra	T	A	13: 112,523,997	D605V	possibly damaging	Het
Insm2	G	A	12: 55,600,197	C242Y	probably damaging	Het
Ints3	C	T	3: 90,415,561	V121I	probably benign	Het
Kcnt2	A	T	1: 140,351,256	L48F	possibly damaging	Het
Kit	G	A	5: 75,640,540	V529M	probably damaging	Het
Mark2	G	A	19: 7,283,074	P13S	probably damaging	Het
Mthfsd	A	G	8: 121,098,740	V364A	probably damaging	Het
Mtmr11	C	G	3: 96,164,319	S185R	probably benign	Het
Myot	A	G	18: 44,354,214	I373V	probably benign	Het
N4bp3	A	T	11: 51,645,312	V231D	probably benign	Het
Olfr1089	A	T	2: 86,732,777	Y278*	probably null	Het
Olfr1102	T	C	2: 87,002,038	V23A	probably benign	Het
Pdcd6ip	A	G	9: 113,691,542	F125L	probably damaging	Het
Prpf39	A	T	12: 65,048,277	Q124L	probably benign	Het
Reln	A	T	5: 21,988,765	N1398K	probably damaging	Het
Rhod	A	T	19: 4,432,094	D97E	probably damaging	Het
Rxra	T	C	2: 27,757,868		probably null	Het
Slc1a3	T	C	15: 8,642,949	I349V	probably benign	Het
Slc37a2	A	T	9: 37,231,643	*502R	probably null	Het
Slc9b1	T	C	3: 135,373,179	I199T	probably damaging	Het
Spg20	C	T	3: 55,117,329	P115L	probably damaging	Het
Tnpo1	A	T	13: 98,870,305	C205S	possibly damaging	Het
Tubb1	T	A	2: 174,456,864	I113N	probably benign	Het
Tyrp1	G	A	4: 80,850,717	V483I	probably benign	Het
Vwde	T	C	6: 13,215,758	S100G	probably benign	Het
Zfhx3	A	T	8: 108,800,575	I1035F	probably damaging	Het
Zfp618	G	T	4: 63,133,209	K742N	probably damaging	Het
Zfp873	T	C	10: 82,060,191	V252A	possibly damaging	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4695:Cd180	UTSW	13	102705760	missense	probably benign	0.01
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5052:Cd180	UTSW	13	102704895	missense	probably benign
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6456:Cd180	UTSW	13	102702836	missense	probably damaging	1.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6815:Cd180	UTSW	13	102705429	missense	probably damaging	1.00
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7048:Cd180	UTSW	13	102704923	missense	probably damaging	0.99
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAAAATCTCCGCGAACTTGACC -3'
(R):5'- AAACCAGGATTTCTAGTCTTCCC -3'

Sequencing Primer
(F):5'- TGACCTCAGCCATGATGACATTG -3'
(R):5'- CTTCCCAGTGTCTGAAGTGAG -3'

Posted On

2016-06-21