Incidental Mutation 'R5154:Chtf18'
ID396614
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission 042736-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R5154 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25723720 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 412 (T412A)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047273] [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably benign
Transcript: ENSMUST00000047273
SMART Domains Protein: ENSMUSP00000043825
Gene: ENSMUSG00000041199

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 17 182 4.1e-27 PFAM
low complexity region 271 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048054
AA Change: T412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: T412A

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,938 H48P probably damaging Het
Angptl7 C T 4: 148,497,425 R168H probably damaging Het
Ankrd11 A C 8: 122,893,139 F1325V probably damaging Het
Ankrd13c A G 3: 157,988,660 D266G possibly damaging Het
Apold1 A T 6: 134,983,673 H30L possibly damaging Het
Arel1 A G 12: 84,931,773 F362L probably benign Het
Arhgef4 T A 1: 34,732,374 M1254K probably benign Het
Arid2 T A 15: 96,401,985 V1793E probably damaging Het
Bcl7a T C 5: 123,369,359 S156P probably damaging Het
Cbr3 A G 16: 93,685,139 I128V probably benign Het
Cct6b G A 11: 82,739,695 P299L probably damaging Het
Cd180 A T 13: 102,705,774 N443Y probably damaging Het
Cd80 A G 16: 38,473,980 K75R probably benign Het
Cdk1 A T 10: 69,340,468 probably benign Het
Cep192 T A 18: 67,850,684 F1565I probably damaging Het
Cit T C 5: 115,988,405 L1590P probably damaging Het
Clcn2 T A 16: 20,703,303 R845S probably benign Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Cnnm2 A T 19: 46,763,132 R454W probably benign Het
Cpne8 T G 15: 90,499,918 I480L probably benign Het
Cr2 A G 1: 195,159,446 W400R probably damaging Het
Cul5 A G 9: 53,625,867 L528P probably damaging Het
Dlgap5 C T 14: 47,413,720 V119M probably damaging Het
Dnah12 T C 14: 26,849,363 S190P probably benign Het
Dnah3 T A 7: 119,952,419 K2881N probably damaging Het
Dnmt3a A T 12: 3,896,008 I288F probably damaging Het
Dse T A 10: 34,153,661 T478S possibly damaging Het
Edn1 C T 13: 42,305,023 T104I probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eprs A G 1: 185,413,465 H1157R probably damaging Het
Fam168b G A 1: 34,818,099 T179I possibly damaging Het
Fzd5 A G 1: 64,735,972 V210A probably benign Het
Gm9742 T C 13: 8,035,045 noncoding transcript Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Gpr141 C T 13: 19,752,242 R121K probably benign Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Grk3 A T 5: 112,941,717 I281N probably damaging Het
Hnrnpdl A T 5: 100,036,512 Y289* probably null Het
Hsf2 T G 10: 57,504,712 V214G probably benign Het
Igf2bp1 G A 11: 95,963,547 Q563* probably null Het
Il31ra T A 13: 112,523,997 D605V possibly damaging Het
Insm2 G A 12: 55,600,197 C242Y probably damaging Het
Ints3 C T 3: 90,415,561 V121I probably benign Het
Kcnt2 A T 1: 140,351,256 L48F possibly damaging Het
Kit G A 5: 75,640,540 V529M probably damaging Het
Mark2 G A 19: 7,283,074 P13S probably damaging Het
Mthfsd A G 8: 121,098,740 V364A probably damaging Het
Mtmr11 C G 3: 96,164,319 S185R probably benign Het
Myot A G 18: 44,354,214 I373V probably benign Het
N4bp3 A T 11: 51,645,312 V231D probably benign Het
Olfr1089 A T 2: 86,732,777 Y278* probably null Het
Olfr1102 T C 2: 87,002,038 V23A probably benign Het
Pdcd6ip A G 9: 113,691,542 F125L probably damaging Het
Prpf39 A T 12: 65,048,277 Q124L probably benign Het
Reln A T 5: 21,988,765 N1398K probably damaging Het
Rhod A T 19: 4,432,094 D97E probably damaging Het
Rxra T C 2: 27,757,868 probably null Het
Slc1a3 T C 15: 8,642,949 I349V probably benign Het
Slc37a2 A T 9: 37,231,643 *502R probably null Het
Slc9b1 T C 3: 135,373,179 I199T probably damaging Het
Spg20 C T 3: 55,117,329 P115L probably damaging Het
Tnpo1 A T 13: 98,870,305 C205S possibly damaging Het
Tubb1 T A 2: 174,456,864 I113N probably benign Het
Tyrp1 G A 4: 80,850,717 V483I probably benign Het
Vwde T C 6: 13,215,758 S100G probably benign Het
Zfhx3 A T 8: 108,800,575 I1035F probably damaging Het
Zfp618 G T 4: 63,133,209 K742N probably damaging Het
Zfp873 T C 10: 82,060,191 V252A possibly damaging Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 intron probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCAAAAGAACGTTGATGGCCG -3'
(R):5'- TTCTCAAACCCTGGCTAGTGG -3'

Sequencing Primer
(F):5'- AACGTTGATGGCCGCCTTC -3'
(R):5'- CTAGGGTCCTGGATATTGGATGTAG -3'
Posted On2016-06-21