Incidental Mutation 'R5155:Phf3'
ID 396624
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene Name PHD finger protein 3
Synonyms AU020177, 2310061N19Rik
MMRRC Submission 042737-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5155 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 30841417-30912989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30863457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 756 (D756G)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191064]
AlphaFold B2RQG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000088310
AA Change: D756G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: D756G

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186105
Predicted Effect possibly damaging
Transcript: ENSMUST00000186733
AA Change: D756G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: D756G

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188847
Predicted Effect probably benign
Transcript: ENSMUST00000191064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191245
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,482,447 (GRCm39) V4326A probably damaging Het
Actn4 A G 7: 28,661,442 (GRCm39) probably null Het
Adamts8 A G 9: 30,865,844 (GRCm39) D464G probably benign Het
Adss1 T C 12: 112,604,642 (GRCm39) I366T probably damaging Het
Alox12e T C 11: 70,207,081 (GRCm39) D575G possibly damaging Het
Ankrd44 A T 1: 54,817,489 (GRCm39) M73K probably benign Het
Ap4e1 A G 2: 126,905,289 (GRCm39) T987A probably benign Het
Banp A C 8: 122,727,759 (GRCm39) S318R probably damaging Het
Bcas1 T C 2: 170,260,538 (GRCm39) H47R probably damaging Het
Brwd1 G T 16: 95,803,993 (GRCm39) S2524* probably null Het
Btbd8 T C 5: 107,638,569 (GRCm39) I323T probably damaging Het
Cand2 T A 6: 115,769,219 (GRCm39) D676E probably benign Het
Cc2d1a A T 8: 84,867,755 (GRCm39) H224Q probably benign Het
Ccdc138 A T 10: 58,343,394 (GRCm39) Y83F probably benign Het
Ccdc162 A T 10: 41,429,576 (GRCm39) probably null Het
Ccdc162 A C 10: 41,455,147 (GRCm39) S396A probably damaging Het
Ces1e A T 8: 93,928,034 (GRCm39) *562R probably null Het
Clstn2 T A 9: 97,338,484 (GRCm39) M892L probably benign Het
Crybg3 T C 16: 59,345,264 (GRCm39) T2673A possibly damaging Het
Cstf3 A G 2: 104,482,830 (GRCm39) N326S probably benign Het
Cux1 G A 5: 136,594,295 (GRCm39) probably benign Het
Cyb5r4 T G 9: 86,922,456 (GRCm39) M155R probably benign Het
D130043K22Rik A G 13: 25,056,273 (GRCm39) D535G probably damaging Het
Dnah2 G A 11: 69,313,362 (GRCm39) P4266S probably damaging Het
Dnah7a T A 1: 53,682,654 (GRCm39) N272I probably benign Het
Dsg2 A G 18: 20,731,715 (GRCm39) Y779C possibly damaging Het
Eif4g3 T A 4: 137,854,054 (GRCm39) N507K probably benign Het
Elavl4 T C 4: 110,149,833 (GRCm39) Q3R probably null Het
Engase T G 11: 118,372,107 (GRCm39) I133S probably benign Het
Ercc5 T C 1: 44,219,782 (GRCm39) V1018A probably damaging Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam8a1 G A 13: 46,827,038 (GRCm39) A270T probably benign Het
Fhdc1 T G 3: 84,353,457 (GRCm39) Q589H probably benign Het
Gatm G A 2: 122,440,334 (GRCm39) T35I probably benign Het
Gcgr T C 11: 120,427,872 (GRCm39) I271T probably benign Het
Gm527 T A 12: 64,970,381 (GRCm39) Y239N probably damaging Het
H2-Ab1 A G 17: 34,486,358 (GRCm39) H139R possibly damaging Het
Herc2 G A 7: 55,877,574 (GRCm39) R4547Q possibly damaging Het
Itga1 A T 13: 115,171,839 (GRCm39) S89T probably benign Het
Kash5 C A 7: 44,839,078 (GRCm39) E53* probably null Het
Katnip A G 7: 125,471,356 (GRCm39) T1486A probably damaging Het
Lrba A G 3: 86,258,607 (GRCm39) M1365V probably benign Het
Lrp1b A C 2: 41,618,634 (GRCm39) probably null Het
Map1a G A 2: 121,132,867 (GRCm39) A990T probably damaging Het
Micall2 C A 5: 139,695,986 (GRCm39) L784F probably damaging Het
Mmp9 T C 2: 164,790,986 (GRCm39) probably null Het
Mrps7 T A 11: 115,495,655 (GRCm39) Y64* probably null Het
Mslnl C T 17: 25,957,942 (GRCm39) Q62* probably null Het
Nfil3 A G 13: 53,122,616 (GRCm39) L96P probably damaging Het
Or2f1 A G 6: 42,721,748 (GRCm39) Y259C probably damaging Het
Plxnd1 C T 6: 115,935,949 (GRCm39) probably null Het
Prickle4 C T 17: 48,000,982 (GRCm39) probably null Het
Prr9 T A 3: 92,030,356 (GRCm39) T95S possibly damaging Het
Prrc2a A G 17: 35,379,067 (GRCm39) probably null Het
Prrt3 A G 6: 113,474,520 (GRCm39) probably null Het
Psme4 A T 11: 30,826,806 (GRCm39) Y1775F probably damaging Het
Pum2 T C 12: 8,763,572 (GRCm39) V243A possibly damaging Het
Rnf32 T C 5: 29,408,145 (GRCm39) S125P probably damaging Het
Rnf8 A G 17: 29,845,604 (GRCm39) Y65C probably damaging Het
Rph3a T C 5: 121,086,833 (GRCm39) T456A possibly damaging Het
Scaper T A 9: 55,463,370 (GRCm39) Q854L probably null Het
Sez6l2 T C 7: 126,561,545 (GRCm39) S472P probably damaging Het
Spsb3 T C 17: 25,105,969 (GRCm39) probably benign Het
Srebf2 A G 15: 82,080,427 (GRCm39) D40G probably damaging Het
Sspo A G 6: 48,437,408 (GRCm39) N1389D probably benign Het
Taf4b G T 18: 14,963,152 (GRCm39) A631S probably benign Het
Tcstv1b T C 13: 120,635,089 (GRCm39) S124P probably benign Het
Tigd4 G A 3: 84,501,970 (GRCm39) V296M possibly damaging Het
Tsc22d2 T A 3: 58,324,737 (GRCm39) probably benign Het
Uso1 T A 5: 92,315,194 (GRCm39) probably null Het
Vmn2r6 T G 3: 64,445,935 (GRCm39) N597H probably benign Het
Zfc3h1 T A 10: 115,248,026 (GRCm39) S1076R possibly damaging Het
Zfp64 T A 2: 168,748,885 (GRCm39) Q44L probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30,850,928 (GRCm39) missense probably damaging 0.99
IGL00704:Phf3 APN 1 30,843,919 (GRCm39) missense probably benign
IGL01147:Phf3 APN 1 30,843,250 (GRCm39) missense probably damaging 1.00
IGL01360:Phf3 APN 1 30,847,809 (GRCm39) missense probably damaging 1.00
IGL01376:Phf3 APN 1 30,869,566 (GRCm39) missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30,843,386 (GRCm39) nonsense probably null
IGL01830:Phf3 APN 1 30,853,148 (GRCm39) nonsense probably null
IGL02108:Phf3 APN 1 30,869,032 (GRCm39) missense probably damaging 1.00
IGL02156:Phf3 APN 1 30,847,859 (GRCm39) missense probably damaging 1.00
IGL02576:Phf3 APN 1 30,869,117 (GRCm39) missense probably benign 0.01
IGL03031:Phf3 APN 1 30,843,734 (GRCm39) missense probably benign 0.00
IGL03334:Phf3 APN 1 30,844,810 (GRCm39) missense probably damaging 0.99
IGL03411:Phf3 APN 1 30,843,482 (GRCm39) missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30,844,104 (GRCm39) utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30,855,622 (GRCm39) missense probably damaging 1.00
R0037:Phf3 UTSW 1 30,843,999 (GRCm39) missense probably benign 0.03
R0052:Phf3 UTSW 1 30,847,848 (GRCm39) missense probably damaging 1.00
R0114:Phf3 UTSW 1 30,844,524 (GRCm39) missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0225:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0715:Phf3 UTSW 1 30,850,919 (GRCm39) missense probably damaging 1.00
R0835:Phf3 UTSW 1 30,869,632 (GRCm39) missense probably benign 0.02
R0848:Phf3 UTSW 1 30,902,253 (GRCm39) missense probably damaging 1.00
R1473:Phf3 UTSW 1 30,845,021 (GRCm39) missense probably damaging 1.00
R1522:Phf3 UTSW 1 30,844,729 (GRCm39) missense probably benign 0.05
R1549:Phf3 UTSW 1 30,843,923 (GRCm39) missense probably benign 0.00
R1555:Phf3 UTSW 1 30,844,958 (GRCm39) missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30,851,023 (GRCm39) missense probably damaging 1.00
R1789:Phf3 UTSW 1 30,845,287 (GRCm39) missense probably damaging 1.00
R1875:Phf3 UTSW 1 30,869,704 (GRCm39) missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R1957:Phf3 UTSW 1 30,870,601 (GRCm39) missense probably damaging 1.00
R2019:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R2259:Phf3 UTSW 1 30,843,424 (GRCm39) missense probably benign 0.20
R2305:Phf3 UTSW 1 30,844,556 (GRCm39) nonsense probably null
R2345:Phf3 UTSW 1 30,844,432 (GRCm39) nonsense probably null
R2424:Phf3 UTSW 1 30,845,430 (GRCm39) missense probably damaging 1.00
R2497:Phf3 UTSW 1 30,869,095 (GRCm39) missense probably damaging 1.00
R2504:Phf3 UTSW 1 30,849,870 (GRCm39) missense probably damaging 1.00
R3522:Phf3 UTSW 1 30,844,684 (GRCm39) missense probably damaging 1.00
R3816:Phf3 UTSW 1 30,844,834 (GRCm39) missense probably damaging 1.00
R4152:Phf3 UTSW 1 30,870,539 (GRCm39) missense probably benign 0.13
R4403:Phf3 UTSW 1 30,843,490 (GRCm39) missense probably damaging 1.00
R4658:Phf3 UTSW 1 30,902,169 (GRCm39) missense probably damaging 1.00
R4663:Phf3 UTSW 1 30,860,296 (GRCm39) missense probably damaging 1.00
R4669:Phf3 UTSW 1 30,869,027 (GRCm39) missense probably damaging 1.00
R4706:Phf3 UTSW 1 30,844,687 (GRCm39) missense probably damaging 1.00
R4757:Phf3 UTSW 1 30,859,908 (GRCm39) missense probably damaging 1.00
R4766:Phf3 UTSW 1 30,853,020 (GRCm39) unclassified probably benign
R4786:Phf3 UTSW 1 30,855,638 (GRCm39) nonsense probably null
R5107:Phf3 UTSW 1 30,870,566 (GRCm39) missense probably benign 0.03
R5310:Phf3 UTSW 1 30,842,887 (GRCm39) missense probably damaging 1.00
R5823:Phf3 UTSW 1 30,843,764 (GRCm39) missense probably damaging 1.00
R5944:Phf3 UTSW 1 30,859,785 (GRCm39) missense probably damaging 1.00
R5979:Phf3 UTSW 1 30,844,827 (GRCm39) missense probably damaging 1.00
R6007:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R6024:Phf3 UTSW 1 30,902,307 (GRCm39) missense probably damaging 1.00
R6072:Phf3 UTSW 1 30,869,769 (GRCm39) missense probably benign 0.08
R6533:Phf3 UTSW 1 30,845,399 (GRCm39) missense probably damaging 1.00
R6649:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30,843,711 (GRCm39) missense probably damaging 0.97
R6855:Phf3 UTSW 1 30,859,204 (GRCm39) missense probably damaging 1.00
R6862:Phf3 UTSW 1 30,853,063 (GRCm39) missense probably damaging 1.00
R6930:Phf3 UTSW 1 30,850,958 (GRCm39) missense probably damaging 1.00
R7135:Phf3 UTSW 1 30,870,190 (GRCm39) missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30,852,211 (GRCm39) missense probably benign 0.01
R7352:Phf3 UTSW 1 30,843,407 (GRCm39) missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30,876,239 (GRCm39) missense probably damaging 0.96
R7549:Phf3 UTSW 1 30,870,556 (GRCm39) missense probably benign 0.01
R7609:Phf3 UTSW 1 30,844,582 (GRCm39) missense probably benign 0.05
R7720:Phf3 UTSW 1 30,868,938 (GRCm39) missense probably damaging 1.00
R7745:Phf3 UTSW 1 30,843,305 (GRCm39) missense probably damaging 1.00
R8134:Phf3 UTSW 1 30,863,552 (GRCm39) missense unknown
R8264:Phf3 UTSW 1 30,870,138 (GRCm39) missense possibly damaging 0.48
R8545:Phf3 UTSW 1 30,863,391 (GRCm39) missense possibly damaging 0.48
R8821:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8831:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8873:Phf3 UTSW 1 30,843,773 (GRCm39) missense possibly damaging 0.74
R9101:Phf3 UTSW 1 30,843,026 (GRCm39) missense possibly damaging 0.56
R9402:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R9426:Phf3 UTSW 1 30,870,625 (GRCm39) nonsense probably null
R9594:Phf3 UTSW 1 30,869,003 (GRCm39) missense probably benign 0.07
R9707:Phf3 UTSW 1 30,868,923 (GRCm39) critical splice donor site probably null
R9803:Phf3 UTSW 1 30,869,872 (GRCm39) missense probably benign 0.16
Z1177:Phf3 UTSW 1 30,851,049 (GRCm39) critical splice acceptor site probably null
Z1177:Phf3 UTSW 1 30,844,132 (GRCm39) missense unknown
Z1177:Phf3 UTSW 1 30,843,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCTGGAAACCTTACCCG -3'
(R):5'- CGTTCATGGAAAATAGGAACAGTGTC -3'

Sequencing Primer
(F):5'- CCGTTTTAAAATTTTGACCTTGTGC -3'
(R):5'- AGGAACAGTGTCTGAACATTAAAC -3'
Posted On 2016-06-21