Mutagenetix > Incidental Mutation

Incidental Mutation 'R5155:Phf3'

396624

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

MMRRC Submission

042737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30824376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 756 (D756G)

Ref Sequence

ENSEMBL: ENSMUSP00000139610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191064]

AlphaFold

B2RQG2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088310
AA Change: D756G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: D756G

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186105

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186733
AA Change: D756G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: D756G

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188847

Predicted Effect

probably benign
Transcript: ENSMUST00000191064

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191245

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
PIT4458001:Phf3	UTSW	1	30816541	missense	probably damaging	1.00
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1780:Phf3	UTSW	1	30811942	missense	probably damaging	1.00
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8134:Phf3	UTSW	1	30824471	missense	unknown
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
R8821:Phf3	UTSW	1	30821266	nonsense	probably null
R8831:Phf3	UTSW	1	30821266	nonsense	probably null
R8873:Phf3	UTSW	1	30804692	missense	possibly damaging	0.74
R9101:Phf3	UTSW	1	30803945	missense	possibly damaging	0.56
R9402:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R9426:Phf3	UTSW	1	30831544	nonsense	probably null
R9594:Phf3	UTSW	1	30829922	missense	probably benign	0.07
R9707:Phf3	UTSW	1	30829842	critical splice donor site	probably null
R9803:Phf3	UTSW	1	30830791	missense	probably benign	0.16
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTCTGGAAACCTTACCCG -3'
(R):5'- CGTTCATGGAAAATAGGAACAGTGTC -3'

Sequencing Primer
(F):5'- CCGTTTTAAAATTTTGACCTTGTGC -3'
(R):5'- AGGAACAGTGTCTGAACATTAAAC -3'

Posted On

2016-06-21