Incidental Mutation 'R5155:Ercc5'
ID396625
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44180622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1018 (V1018A)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
Predicted Effect probably damaging
Transcript: ENSMUST00000027214
AA Change: V1018A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V1018A

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7987:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTAATCCACAGTTCGACGCG -3'
(R):5'- TCACAGATGAACCTTCTCCATC -3'

Sequencing Primer
(F):5'- CGTTAGTTGGTGTAGCAACTACTCAC -3'
(R):5'- ATTCTGAGCAGTAGGGGTCCC -3'
Posted On2016-06-21