Incidental Mutation 'R5155:Cstf3'
ID396629
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms4732468G05Rik
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104590523-104665429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104652485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 326 (N326S)
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
PDB Structure Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028599
AA Change: N326S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176
AA Change: N326S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129571
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104646631 missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104609194 splice site probably benign
IGL03025:Cstf3 APN 2 104608931 missense possibly damaging 0.82
Amanita UTSW 2 104590581 start gained probably benign
Ptomaine UTSW 2 104649462 missense probably benign
R0043:Cstf3 UTSW 2 104645085 splice site probably benign
R0189:Cstf3 UTSW 2 104652446 missense probably damaging 1.00
R0332:Cstf3 UTSW 2 104646467 critical splice donor site probably null
R0499:Cstf3 UTSW 2 104649605 missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104648219 missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104664278 intron probably benign
R1881:Cstf3 UTSW 2 104654218 missense probably benign
R1916:Cstf3 UTSW 2 104655756 missense possibly damaging 0.90
R3720:Cstf3 UTSW 2 104653086 splice site probably benign
R3813:Cstf3 UTSW 2 104609121 missense probably damaging 1.00
R5304:Cstf3 UTSW 2 104663390 nonsense probably null
R5564:Cstf3 UTSW 2 104609002 intron probably benign
R5869:Cstf3 UTSW 2 104659240 splice site probably null
R6172:Cstf3 UTSW 2 104651642 missense probably damaging 1.00
R6747:Cstf3 UTSW 2 104646767 missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104655731 missense probably benign 0.22
R6959:Cstf3 UTSW 2 104649462 missense probably benign
R7139:Cstf3 UTSW 2 104653064 missense possibly damaging 0.87
R7143:Cstf3 UTSW 2 104646616 missense probably benign 0.01
R7350:Cstf3 UTSW 2 104608956 missense probably damaging 1.00
R7794:Cstf3 UTSW 2 104590581 start gained probably benign
R8315:Cstf3 UTSW 2 104590581 start gained probably benign
X0013:Cstf3 UTSW 2 104659277 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GGCCCTAGAAACTCTCTTCTGC -3'
(R):5'- CACCAGGTTTAGGAAGAATCATG -3'

Sequencing Primer
(F):5'- TCTCTTCTGCTCAGAACAAGAAG -3'
(R):5'- TCATGAGTTTGAGGGCCACATAC -3'
Posted On2016-06-21