Incidental Mutation 'R5155:Ap4e1'
ID396632
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Nameadaptor-related protein complex AP-4, epsilon 1
Synonyms2310033A20Rik
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127008717-127067909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127063369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 987 (T987A)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000142740] [ENSMUST00000177372]
Predicted Effect probably benign
Transcript: ENSMUST00000002063
AA Change: T987A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: T987A

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142740
Predicted Effect probably benign
Transcript: ENSMUST00000177372
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 127046186 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 127037864 splice site probably null
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6180:Ap4e1 UTSW 2 127066588 nonsense probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7144:Ap4e1 UTSW 2 127011807 missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7348:Ap4e1 UTSW 2 127061977 missense possibly damaging 0.76
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCAGTAGAAGATTACTATCCACA -3'
(R):5'- AGTGGGAGAGAGTTAAGATTTACAT -3'

Sequencing Primer
(F):5'- CCACATAACAGTTTATTGATGCTTTC -3'
(R):5'- GGTGTTAGGAACCAAACTCTAGTCC -3'
Posted On2016-06-21