Incidental Mutation 'R5155:Tigd4'
ID396639
Institutional Source Beutler Lab
Gene Symbol Tigd4
Ensembl Gene ENSMUSG00000047819
Gene Nametigger transposable element derived 4
SynonymsTigd4, C130063O11Rik
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84593574-84597032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84594663 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 296 (V296M)
Ref Sequence ENSEMBL: ENSMUSP00000052320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062623] [ENSMUST00000154148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062623
AA Change: V296M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052320
Gene: ENSMUSG00000047819
AA Change: V296M

DomainStartEndE-ValueType
Pfam:CENP-B_N 15 67 9e-14 PFAM
CENPB 81 146 5.52e-16 SMART
Pfam:DDE_1 211 375 4.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Tigd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Tigd4 APN 3 84594745 missense probably damaging 1.00
R0080:Tigd4 UTSW 3 84594145 missense probably benign 0.19
R0320:Tigd4 UTSW 3 84595174 missense probably benign
R0347:Tigd4 UTSW 3 84593860 missense probably damaging 1.00
R1875:Tigd4 UTSW 3 84595087 missense probably benign 0.00
R1876:Tigd4 UTSW 3 84593935 nonsense probably null
R2142:Tigd4 UTSW 3 84594363 missense possibly damaging 0.95
R2258:Tigd4 UTSW 3 84594293 missense probably benign 0.00
R2519:Tigd4 UTSW 3 84593914 missense probably damaging 1.00
R2866:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R3974:Tigd4 UTSW 3 84595278 missense possibly damaging 0.82
R4094:Tigd4 UTSW 3 84594640 missense probably damaging 1.00
R4967:Tigd4 UTSW 3 84595153 missense probably benign 0.03
R5878:Tigd4 UTSW 3 84594442 missense probably benign 0.09
R6174:Tigd4 UTSW 3 84595267 missense probably benign 0.02
R6960:Tigd4 UTSW 3 84594116 missense probably damaging 1.00
R7414:Tigd4 UTSW 3 84593821 missense probably benign 0.37
R7445:Tigd4 UTSW 3 84595164 missense probably benign 0.01
R7696:Tigd4 UTSW 3 84594917 missense possibly damaging 0.89
R7810:Tigd4 UTSW 3 84595003 missense possibly damaging 0.49
X0023:Tigd4 UTSW 3 84593857 missense probably damaging 1.00
X0064:Tigd4 UTSW 3 84594478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTCCCTTTGCTGATC -3'
(R):5'- GCAGAGATGCAATGTATCAACTGC -3'

Sequencing Primer
(F):5'- CTTTGCTGATCATCGGGAAAAACC -3'
(R):5'- GCAATGTATCAACTGCATCTAGAAG -3'
Posted On2016-06-21