Mutagenetix > Incidental Mutations

Incidental Mutation 'R5155:Eif4g3'

396644

Institutional Source

Beutler Lab

Gene Symbol

Eif4g3

Ensembl Gene

ENSMUSG00000028760

Gene Name

eukaryotic translation initiation factor 4 gamma, 3

Synonyms

1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII

MMRRC Submission

042737-MU

Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137993022-138208508 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 138126743 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 507 (N507K)

Ref Sequence

ENSEMBL: ENSMUSP00000101456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105830] [ENSMUST00000105831] [ENSMUST00000203828]

Predicted Effect

probably benign
Transcript: ENSMUST00000084214

SMART Domains

Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
low complexity region	147	152	N/A	INTRINSIC
PDB:1LJ2\|D	154	179	8e-9	PDB
low complexity region	192	207	N/A	INTRINSIC
low complexity region	269	310	N/A	INTRINSIC
low complexity region	427	444	N/A	INTRINSIC
low complexity region	534	550	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	592	616	N/A	INTRINSIC
Blast:MIF4G	617	708	5e-49	BLAST
Blast:MIF4G	722	765	5e-16	BLAST
MIF4G	768	996	1.42e-65	SMART
low complexity region	1086	1109	N/A	INTRINSIC
MA3	1215	1327	9.29e-38	SMART
eIF5C	1487	1574	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084215

SMART Domains

Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
low complexity region	75	102	N/A	INTRINSIC
low complexity region	129	134	N/A	INTRINSIC
PDB:1LJ2\|D	136	161	8e-9	PDB
low complexity region	174	189	N/A	INTRINSIC
low complexity region	251	292	N/A	INTRINSIC
low complexity region	409	426	N/A	INTRINSIC
low complexity region	516	532	N/A	INTRINSIC
low complexity region	561	570	N/A	INTRINSIC
low complexity region	574	598	N/A	INTRINSIC
Blast:MIF4G	599	690	4e-49	BLAST
Blast:MIF4G	704	747	5e-16	BLAST
MIF4G	750	978	1.42e-65	SMART
low complexity region	1068	1113	N/A	INTRINSIC
MA3	1216	1328	9.29e-38	SMART
eIF5C	1488	1575	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105830
AA Change: N507K

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101456
Gene: ENSMUSG00000028760
AA Change: N507K

Domain	Start	End	E-Value	Type
low complexity region	21	36	N/A	INTRINSIC
low complexity region	86	113	N/A	INTRINSIC
low complexity region	140	145	N/A	INTRINSIC
PDB:1LJ2\|D	147	172	1e-7	PDB
low complexity region	261	302	N/A	INTRINSIC
low complexity region	419	436	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105831

SMART Domains

Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
low complexity region	82	109	N/A	INTRINSIC
low complexity region	136	141	N/A	INTRINSIC
PDB:1LJ2\|D	143	168	8e-9	PDB
low complexity region	181	196	N/A	INTRINSIC
low complexity region	258	299	N/A	INTRINSIC
low complexity region	416	433	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
low complexity region	581	605	N/A	INTRINSIC
Blast:MIF4G	606	697	4e-49	BLAST
Blast:MIF4G	711	754	5e-16	BLAST
MIF4G	757	985	1.42e-65	SMART
low complexity region	1075	1098	N/A	INTRINSIC
MA3	1204	1316	9.29e-38	SMART
eIF5C	1476	1563	7.92e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203828

SMART Domains

Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	41	81	N/A	INTRINSIC
low complexity region	193	208	N/A	INTRINSIC
low complexity region	258	285	N/A	INTRINSIC
low complexity region	312	317	N/A	INTRINSIC
PDB:1LJ2\|D	319	344	9e-9	PDB
low complexity region	357	372	N/A	INTRINSIC
low complexity region	434	475	N/A	INTRINSIC
low complexity region	592	609	N/A	INTRINSIC
low complexity region	699	715	N/A	INTRINSIC
low complexity region	744	753	N/A	INTRINSIC
low complexity region	757	781	N/A	INTRINSIC
Blast:MIF4G	782	873	9e-49	BLAST
Blast:MIF4G	887	930	5e-16	BLAST
MIF4G	933	1161	6e-68	SMART
coiled coil region	1174	1201	N/A	INTRINSIC
low complexity region	1251	1296	N/A	INTRINSIC
MA3	1399	1511	3.9e-40	SMART
eIF5C	1671	1758	3.9e-38	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]

Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Eif4g3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01817:Eif4g3	APN	4	138120362	missense	probably benign	0.01
IGL02171:Eif4g3	APN	4	138126589	missense	probably benign	0.03
IGL02487:Eif4g3	APN	4	138203378	missense	possibly damaging	0.92
IGL02514:Eif4g3	APN	4	138126194	missense	possibly damaging	0.87
IGL02622:Eif4g3	APN	4	138097366	splice site	probably benign
IGL02725:Eif4g3	APN	4	138170471	splice site	probably benign
IGL02735:Eif4g3	APN	4	138126211	missense	probably benign	0.40
IGL03008:Eif4g3	APN	4	138120388	missense	probably damaging	1.00
IGL03077:Eif4g3	APN	4	138125855	missense	probably damaging	1.00
N/A - 535:Eif4g3	UTSW	4	138120428	missense	probably damaging	0.98
R0013:Eif4g3	UTSW	4	138175848	missense	possibly damaging	0.88
R0193:Eif4g3	UTSW	4	138146376	splice site	probably benign
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0563:Eif4g3	UTSW	4	138175840	splice site	probably benign
R0841:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R0884:Eif4g3	UTSW	4	138151776	missense	possibly damaging	0.76
R1116:Eif4g3	UTSW	4	138091775	critical splice donor site	probably null
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1192:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R1401:Eif4g3	UTSW	4	138206084	missense	probably damaging	0.99
R1535:Eif4g3	UTSW	4	138097302	missense	probably damaging	1.00
R1571:Eif4g3	UTSW	4	138120408	missense	probably damaging	1.00
R1576:Eif4g3	UTSW	4	138096870	missense	probably damaging	0.99
R1607:Eif4g3	UTSW	4	138126563	missense	probably benign	0.00
R1618:Eif4g3	UTSW	4	138206058	missense	probably damaging	1.00
R1793:Eif4g3	UTSW	4	138171131	missense	probably damaging	1.00
R1823:Eif4g3	UTSW	4	138180491	missense	probably benign	0.37
R1857:Eif4g3	UTSW	4	138175876	missense	possibly damaging	0.67
R1907:Eif4g3	UTSW	4	138158415	missense	probably damaging	1.00
R2041:Eif4g3	UTSW	4	138105306	splice site	probably benign
R2106:Eif4g3	UTSW	4	138082919	start gained	probably benign
R2124:Eif4g3	UTSW	4	138184742	missense	probably damaging	1.00
R2301:Eif4g3	UTSW	4	138172659	missense	probably damaging	1.00
R2519:Eif4g3	UTSW	4	138097318	missense	probably benign	0.37
R3033:Eif4g3	UTSW	4	138103410	missense	probably damaging	1.00
R3870:Eif4g3	UTSW	4	138096900	missense	probably damaging	0.98
R4542:Eif4g3	UTSW	4	138203417	missense	probably damaging	0.99
R4582:Eif4g3	UTSW	4	138171245	missense	probably damaging	1.00
R4607:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4608:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4658:Eif4g3	UTSW	4	138206132	missense	probably damaging	1.00
R4736:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4739:Eif4g3	UTSW	4	138183199	missense	possibly damaging	0.79
R4739:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4740:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4760:Eif4g3	UTSW	4	138084318	missense	possibly damaging	0.46
R4825:Eif4g3	UTSW	4	138194081	missense	probably benign
R4826:Eif4g3	UTSW	4	138177945	missense	possibly damaging	0.95
R4941:Eif4g3	UTSW	4	138170565	missense	probably damaging	1.00
R5040:Eif4g3	UTSW	4	138096889	missense	probably damaging	0.99
R5070:Eif4g3	UTSW	4	138146299	missense	probably benign	0.00
R5226:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5229:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5303:Eif4g3	UTSW	4	138126562	missense	probably benign	0.04
R5369:Eif4g3	UTSW	4	138183334	missense	possibly damaging	0.87
R5394:Eif4g3	UTSW	4	138103398	unclassified	probably null
R5665:Eif4g3	UTSW	4	138126589	missense	probably benign	0.03
R5678:Eif4g3	UTSW	4	138151742	missense	probably damaging	0.99
R5695:Eif4g3	UTSW	4	138163433	splice site	probably null
R5704:Eif4g3	UTSW	4	138190692	missense	probably damaging	1.00
R5924:Eif4g3	UTSW	4	138201926	missense	probably damaging	1.00
R6214:Eif4g3	UTSW	4	138058003	missense	probably damaging	0.99
R6278:Eif4g3	UTSW	4	138188083	missense	possibly damaging	0.82
R6519:Eif4g3	UTSW	4	137994008	missense	probably benign
R6659:Eif4g3	UTSW	4	138177932	missense	probably damaging	1.00
R6720:Eif4g3	UTSW	4	138175832	intron	probably null
R6812:Eif4g3	UTSW	4	138103376	missense	probably damaging	1.00
R6922:Eif4g3	UTSW	4	138097335	missense	probably damaging	1.00
R7175:Eif4g3	UTSW	4	138126215	missense	probably damaging	1.00
R7176:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R7598:Eif4g3	UTSW	4	138194124	missense	probably benign	0.02
R7618:Eif4g3	UTSW	4	138171118	missense	probably damaging	1.00
R7805:Eif4g3	UTSW	4	138146354	missense	probably benign	0.00
RF008:Eif4g3	UTSW	4	138175924	missense	probably damaging	0.98
X0067:Eif4g3	UTSW	4	138163619	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTGAGAACTTGCCTTAGC -3'
(R):5'- TCTAGTTTCGAAGCAACAGAGC -3'

Sequencing Primer
(F):5'- TCAGAATCAGATGGGCAAGC -3'
(R):5'- CTAGTTTCGAAGCAACAGAGCAAAAG -3'

Posted On

2016-06-21