Mutagenetix > Incidental Mutation

Incidental Mutation 'R5155:Uso1'

396647

Institutional Source

Beutler Lab

Gene Symbol

Uso1

Ensembl Gene

ENSMUSG00000029407

Gene Name

USO1 vesicle docking factor

Synonyms

Vdp, TAP, transcytosis associated protein p115

MMRRC Submission

042737-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92137938-92202798 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 92167335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]

AlphaFold

Q9Z1Z0

Predicted Effect

probably null
Transcript: ENSMUST00000031355

SMART Domains

Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	6.5e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
Pfam:Uso1_p115_C	782	954	1.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201380

Predicted Effect

probably benign
Transcript: ENSMUST00000201642

SMART Domains

Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
PDB:3GRL\|A	1	52	5e-24	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000202155

SMART Domains

Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	5.7e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
Pfam:Uso1_p115_C	730	892	2.1e-14	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Uso1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01522:Uso1	APN	5	92181419	missense	probably damaging	0.96
IGL01753:Uso1	APN	5	92152918	critical splice donor site	probably null
IGL02311:Uso1	APN	5	92187776	missense	probably benign
IGL02539:Uso1	APN	5	92187773	missense	probably damaging	1.00
IGL02716:Uso1	APN	5	92173935	missense	probably damaging	0.99
IGL03154:Uso1	APN	5	92180618	nonsense	probably null
R0558:Uso1	UTSW	5	92174019	missense	probably benign	0.03
R0570:Uso1	UTSW	5	92199823	missense	probably benign	0.19
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1398:Uso1	UTSW	5	92181468	missense	probably benign	0.16
R1485:Uso1	UTSW	5	92180563	missense	possibly damaging	0.76
R1813:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1873:Uso1	UTSW	5	92192859	splice site	probably benign
R1896:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1899:Uso1	UTSW	5	92201192	missense	probably benign	0.27
R2049:Uso1	UTSW	5	92181936	missense	probably damaging	1.00
R2128:Uso1	UTSW	5	92195370	missense	probably benign
R2411:Uso1	UTSW	5	92158399	splice site	probably benign
R2903:Uso1	UTSW	5	92195435	critical splice donor site	probably null
R5055:Uso1	UTSW	5	92192735	missense	probably benign	0.31
R5590:Uso1	UTSW	5	92180608	missense	probably benign	0.05
R5665:Uso1	UTSW	5	92198337	missense	possibly damaging	0.95
R5677:Uso1	UTSW	5	92201299	missense	probably damaging	1.00
R5996:Uso1	UTSW	5	92192730	missense	probably benign	0.00
R6165:Uso1	UTSW	5	92187267	missense	probably damaging	1.00
R6340:Uso1	UTSW	5	92199852	missense	probably benign	0.01
R6701:Uso1	UTSW	5	92166585	missense	probably damaging	1.00
R6860:Uso1	UTSW	5	92195348	missense	probably benign	0.11
R7062:Uso1	UTSW	5	92192740	missense	possibly damaging	0.62
R7133:Uso1	UTSW	5	92158465	missense	probably benign	0.12
R7317:Uso1	UTSW	5	92173992	missense	possibly damaging	0.70
R7527:Uso1	UTSW	5	92199875	missense	possibly damaging	0.58
R7648:Uso1	UTSW	5	92194002	splice site	probably null
R7707:Uso1	UTSW	5	92201936	makesense	probably null
R8009:Uso1	UTSW	5	92166580	missense	probably benign	0.03
R8104:Uso1	UTSW	5	92158421	missense	probably damaging	0.99
R8361:Uso1	UTSW	5	92189262	missense	probably null	0.00
R8519:Uso1	UTSW	5	92195363	missense	probably benign
R9052:Uso1	UTSW	5	92180563	missense	probably damaging	1.00
R9142:Uso1	UTSW	5	92187266	nonsense	probably null
R9221:Uso1	UTSW	5	92187314	missense	probably benign	0.38
R9492:Uso1	UTSW	5	92167332	missense	possibly damaging	0.77
R9642:Uso1	UTSW	5	92138108	missense	probably damaging	1.00
Z1177:Uso1	UTSW	5	92138130	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AAAGTAAGGGTCGCTGCCAG -3'
(R):5'- CAACATTTCAGAAGACCATGGAAG -3'

Sequencing Primer
(F):5'- CCAGGACTGAAGCAGTGACCTG -3'
(R):5'- TTTCAGAAGACCATGGAAGAAAGCC -3'

Posted On

2016-06-21