Incidental Mutation 'R5155:Olfr453'
ID396653
Institutional Source Beutler Lab
Gene Symbol Olfr453
Ensembl Gene ENSMUSG00000095831
Gene Nameolfactory receptor 453
SynonymsMOR257-8P, GA_x6K02T2P3E9-4815856-4814903
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42739371-42746963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42744814 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 259 (Y259C)
Ref Sequence ENSEMBL: ENSMUSP00000150467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053647] [ENSMUST00000213997]
Predicted Effect probably damaging
Transcript: ENSMUST00000053647
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052043
Gene: ENSMUSG00000095831
AA Change: Y259C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-54 PFAM
Pfam:7tm_1 41 290 1.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203812
Predicted Effect probably damaging
Transcript: ENSMUST00000213997
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Olfr453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr453 APN 6 42744691 missense probably damaging 1.00
IGL01642:Olfr453 APN 6 42744552 missense probably benign 0.00
IGL02703:Olfr453 APN 6 42744076 missense possibly damaging 0.90
IGL03018:Olfr453 APN 6 42744814 missense probably damaging 1.00
R1163:Olfr453 UTSW 6 42744123 missense probably benign 0.00
R1728:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1729:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1730:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1739:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1784:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2014:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2015:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2130:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2132:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2133:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R3937:Olfr453 UTSW 6 42744076 missense probably damaging 0.98
R4862:Olfr453 UTSW 6 42744555 missense possibly damaging 0.65
R4959:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R4973:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R6581:Olfr453 UTSW 6 42744079 missense probably damaging 1.00
R7028:Olfr453 UTSW 6 42744403 missense probably benign 0.08
R7348:Olfr453 UTSW 6 42744856 missense possibly damaging 0.95
R7490:Olfr453 UTSW 6 42744805 missense probably damaging 1.00
R7522:Olfr453 UTSW 6 42744634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACACCTCTGCCAATGAAGTTG -3'
(R):5'- TGGTGTTCAAGATTCCTCAGG -3'

Sequencing Primer
(F):5'- CTCTGCCAATGAAGTTGCTATCATGG -3'
(R):5'- GTTCAAGATTCCTCAGGTTTTCAG -3'
Posted On2016-06-21