Incidental Mutation 'R5155:Herc2'
ID396661
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase 2
SynonymsD7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location56050196-56231800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56227826 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 4547 (R4547Q)
Ref Sequence ENSEMBL: ENSMUSP00000131573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076226
AA Change: R4547Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: R4547Q

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164095
AA Change: R4547Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: R4547Q

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205303
AA Change: R4511Q

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000205678
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 56124299 missense probably damaging 1.00
IGL00529:Herc2 APN 7 56157753 missense probably benign
IGL00548:Herc2 APN 7 56206565 missense probably benign 0.20
IGL00970:Herc2 APN 7 56181064 splice site probably benign
IGL01141:Herc2 APN 7 56212841 missense possibly damaging 0.47
IGL01147:Herc2 APN 7 56156949 missense probably benign 0.43
IGL01150:Herc2 APN 7 56181133 missense probably damaging 1.00
IGL01519:Herc2 APN 7 56103950 missense probably damaging 1.00
IGL01576:Herc2 APN 7 56226661 critical splice donor site probably null
IGL01626:Herc2 APN 7 56085142 missense probably benign 0.02
IGL01658:Herc2 APN 7 56159452 missense probably damaging 1.00
IGL01707:Herc2 APN 7 56165187 missense probably damaging 1.00
IGL01727:Herc2 APN 7 56137806 missense probably damaging 1.00
IGL01935:Herc2 APN 7 56153793 missense probably benign
IGL01969:Herc2 APN 7 56185831 splice site probably benign
IGL02074:Herc2 APN 7 56087444 splice site probably benign
IGL02261:Herc2 APN 7 56206744 missense probably damaging 0.99
IGL02339:Herc2 APN 7 56121722 missense probably benign 0.01
IGL02353:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02360:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02409:Herc2 APN 7 56220469 splice site probably null
IGL02528:Herc2 APN 7 56108893 splice site probably benign
IGL02571:Herc2 APN 7 56153386 missense probably damaging 1.00
IGL02578:Herc2 APN 7 56106535 splice site probably null
IGL02661:Herc2 APN 7 56113073 missense probably damaging 1.00
IGL02664:Herc2 APN 7 56135678 nonsense probably null
IGL02675:Herc2 APN 7 56164101 missense probably damaging 0.99
IGL02689:Herc2 APN 7 56165283 splice site probably benign
IGL02710:Herc2 APN 7 56137814 missense possibly damaging 0.95
IGL02750:Herc2 APN 7 56204379 splice site probably benign
IGL02754:Herc2 APN 7 56097498 missense probably damaging 1.00
IGL03029:Herc2 APN 7 56168967 missense probably damaging 1.00
IGL03039:Herc2 APN 7 56169021 splice site probably benign
IGL03082:Herc2 APN 7 56185923 missense probably benign 0.19
IGL03090:Herc2 APN 7 56204473 missense probably damaging 0.96
IGL03154:Herc2 APN 7 56202159 missense probably damaging 1.00
IGL03165:Herc2 APN 7 56191912 missense probably damaging 1.00
IGL03201:Herc2 APN 7 56219768 missense probably damaging 1.00
IGL03234:Herc2 APN 7 56103862 missense probably damaging 1.00
IGL03293:Herc2 APN 7 56155130 missense probably benign 0.43
IGL03331:Herc2 APN 7 56135267 splice site probably benign
IGL03340:Herc2 APN 7 56090920 missense possibly damaging 0.51
IGL03409:Herc2 APN 7 56228569 missense probably damaging 1.00
I0000:Herc2 UTSW 7 56136729 splice site probably benign
PIT1430001:Herc2 UTSW 7 56226954 missense probably damaging 1.00
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0058:Herc2 UTSW 7 56170483 missense possibly damaging 0.93
R0114:Herc2 UTSW 7 56153774 splice site probably benign
R0117:Herc2 UTSW 7 56213611 splice site probably benign
R0141:Herc2 UTSW 7 56121561 missense probably benign 0.17
R0266:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0401:Herc2 UTSW 7 56157732 missense probably damaging 0.99
R0403:Herc2 UTSW 7 56159417 missense probably damaging 1.00
R0437:Herc2 UTSW 7 56219815 nonsense probably null
R0491:Herc2 UTSW 7 56122366 missense possibly damaging 0.54
R0499:Herc2 UTSW 7 56184369 nonsense probably null
R0580:Herc2 UTSW 7 56138791 missense probably damaging 1.00
R0650:Herc2 UTSW 7 56113210 missense probably damaging 1.00
R0744:Herc2 UTSW 7 56206036 splice site probably benign
R0798:Herc2 UTSW 7 56135683 critical splice donor site probably null
R0842:Herc2 UTSW 7 56121705 missense probably benign
R0849:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0850:Herc2 UTSW 7 56204483 missense probably benign 0.09
R0926:Herc2 UTSW 7 56132548 missense possibly damaging 0.67
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1292:Herc2 UTSW 7 56197203 missense probably benign 0.05
R1370:Herc2 UTSW 7 56168873 missense probably benign 0.01
R1443:Herc2 UTSW 7 56204733 missense possibly damaging 0.69
R1445:Herc2 UTSW 7 56168996 missense probably damaging 1.00
R1541:Herc2 UTSW 7 56135657 missense probably damaging 1.00
R1550:Herc2 UTSW 7 56135658 missense probably damaging 1.00
R1551:Herc2 UTSW 7 56146669 missense probably benign 0.01
R1633:Herc2 UTSW 7 56229369 missense probably null 1.00
R1635:Herc2 UTSW 7 56136667 missense probably benign 0.00
R1659:Herc2 UTSW 7 56135105 missense probably benign 0.00
R1682:Herc2 UTSW 7 56088400 missense possibly damaging 0.87
R1697:Herc2 UTSW 7 56153905 missense probably benign 0.43
R1748:Herc2 UTSW 7 56148823 critical splice donor site probably null
R1802:Herc2 UTSW 7 56184332 missense probably damaging 1.00
R1835:Herc2 UTSW 7 56206765 nonsense probably null
R1836:Herc2 UTSW 7 56155105 nonsense probably null
R1872:Herc2 UTSW 7 56157509 missense probably benign 0.18
R1889:Herc2 UTSW 7 56189813 missense possibly damaging 0.60
R1906:Herc2 UTSW 7 56114864 missense probably benign 0.01
R2004:Herc2 UTSW 7 56137859 missense probably damaging 1.00
R2030:Herc2 UTSW 7 56184373 missense probably damaging 0.99
R2037:Herc2 UTSW 7 56205961 missense probably damaging 1.00
R2059:Herc2 UTSW 7 56163897 missense probably damaging 1.00
R2068:Herc2 UTSW 7 56132497 missense probably damaging 1.00
R2072:Herc2 UTSW 7 56226964 missense probably damaging 1.00
R2085:Herc2 UTSW 7 56212965 missense possibly damaging 0.94
R2115:Herc2 UTSW 7 56185828 splice site probably benign
R2160:Herc2 UTSW 7 56212922 missense probably benign 0.00
R2173:Herc2 UTSW 7 56185951 missense probably benign 0.27
R2221:Herc2 UTSW 7 56169018 critical splice donor site probably null
R2280:Herc2 UTSW 7 56137271 missense possibly damaging 0.79
R3078:Herc2 UTSW 7 56137243 missense probably benign
R3104:Herc2 UTSW 7 56135355 missense probably benign 0.23
R3177:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3277:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3766:Herc2 UTSW 7 56163824 missense probably damaging 1.00
R3770:Herc2 UTSW 7 56165007 missense probably benign
R3807:Herc2 UTSW 7 56207809 missense probably damaging 1.00
R3912:Herc2 UTSW 7 56098437 missense probably damaging 0.98
R4004:Herc2 UTSW 7 56106465 missense possibly damaging 0.53
R4039:Herc2 UTSW 7 56156411 missense probably damaging 0.98
R4190:Herc2 UTSW 7 56122448 missense probably benign 0.03
R4225:Herc2 UTSW 7 56164987 missense probably damaging 1.00
R4334:Herc2 UTSW 7 56226654 missense probably damaging 1.00
R4405:Herc2 UTSW 7 56170477 missense probably damaging 1.00
R4448:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4450:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4565:Herc2 UTSW 7 56153838 missense possibly damaging 0.71
R4667:Herc2 UTSW 7 56131253 missense probably damaging 1.00
R4747:Herc2 UTSW 7 56106393 missense possibly damaging 0.80
R4762:Herc2 UTSW 7 56170640 missense probably benign 0.19
R4829:Herc2 UTSW 7 56106492 missense probably benign 0.39
R4832:Herc2 UTSW 7 56098417 nonsense probably null
R4895:Herc2 UTSW 7 56222986 missense probably damaging 1.00
R4904:Herc2 UTSW 7 56157486 missense probably damaging 0.99
R4908:Herc2 UTSW 7 56177912 missense probably benign 0.01
R4911:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4921:Herc2 UTSW 7 56229690 missense probably benign 0.04
R4939:Herc2 UTSW 7 56206736 missense probably damaging 1.00
R5184:Herc2 UTSW 7 56122351 missense probably damaging 1.00
R5269:Herc2 UTSW 7 56168870 nonsense probably null
R5306:Herc2 UTSW 7 56184961 missense probably damaging 1.00
R5314:Herc2 UTSW 7 56219786 missense probably damaging 0.99
R5369:Herc2 UTSW 7 56182700 missense probably damaging 1.00
R5418:Herc2 UTSW 7 56137565 missense probably damaging 1.00
R5420:Herc2 UTSW 7 56203830 missense probably damaging 0.96
R5463:Herc2 UTSW 7 56194262 missense probably damaging 1.00
R5510:Herc2 UTSW 7 56206771 missense probably damaging 1.00
R5634:Herc2 UTSW 7 56206783 missense probably damaging 1.00
R5638:Herc2 UTSW 7 56204416 missense probably benign 0.01
R5690:Herc2 UTSW 7 56157705 missense probably benign
R5762:Herc2 UTSW 7 56197190 missense possibly damaging 0.68
R5807:Herc2 UTSW 7 56230919 missense probably damaging 0.99
R5878:Herc2 UTSW 7 56124248 missense probably benign
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6083:Herc2 UTSW 7 56228505 missense probably benign 0.00
R6192:Herc2 UTSW 7 56207762 missense probably damaging 1.00
R6193:Herc2 UTSW 7 56156901 missense probably damaging 0.98
R6261:Herc2 UTSW 7 56197072 nonsense probably null
R6267:Herc2 UTSW 7 56153166 nonsense probably null
R6267:Herc2 UTSW 7 56204718 missense possibly damaging 0.51
R6298:Herc2 UTSW 7 56191265 missense probably benign
R6299:Herc2 UTSW 7 56135055 missense possibly damaging 0.86
R6326:Herc2 UTSW 7 56222934 missense probably damaging 0.98
R6347:Herc2 UTSW 7 56194403 critical splice donor site probably null
R6394:Herc2 UTSW 7 56215981 missense probably damaging 1.00
R6500:Herc2 UTSW 7 56146645 nonsense probably null
R6526:Herc2 UTSW 7 56157330 missense probably damaging 0.99
R6592:Herc2 UTSW 7 56207690 critical splice acceptor site probably null
R6619:Herc2 UTSW 7 56068092 nonsense probably null
R6719:Herc2 UTSW 7 56212826 missense probably damaging 1.00
R6750:Herc2 UTSW 7 56097447 missense probably damaging 1.00
R6807:Herc2 UTSW 7 56164922 missense probably damaging 1.00
R6811:Herc2 UTSW 7 56113433 nonsense probably null
R6837:Herc2 UTSW 7 56189841 missense possibly damaging 0.89
R6838:Herc2 UTSW 7 56108778 missense probably damaging 1.00
R6902:Herc2 UTSW 7 56135486 missense probably benign 0.37
R6983:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56132480 missense probably damaging 1.00
R6986:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6987:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R7113:Herc2 UTSW 7 56203849 missense probably damaging 0.99
R7173:Herc2 UTSW 7 56203827 missense probably damaging 1.00
R7202:Herc2 UTSW 7 56131286 missense probably damaging 0.99
R7205:Herc2 UTSW 7 56182640 missense probably damaging 1.00
R7236:Herc2 UTSW 7 56085080 missense probably benign 0.29
R7297:Herc2 UTSW 7 56136658 missense probably benign 0.00
R7358:Herc2 UTSW 7 56182675 missense possibly damaging 0.48
R7438:Herc2 UTSW 7 56103718 splice site probably null
R7537:Herc2 UTSW 7 56219779 nonsense probably null
R7578:Herc2 UTSW 7 56134800 missense probably benign 0.07
R7614:Herc2 UTSW 7 56153275 nonsense probably null
R7638:Herc2 UTSW 7 56157438 missense probably benign 0.26
R7638:Herc2 UTSW 7 56220525 missense probably damaging 1.00
R7646:Herc2 UTSW 7 56134613 missense probably benign
R7663:Herc2 UTSW 7 56136685 missense probably benign
R7665:Herc2 UTSW 7 56153155 missense probably damaging 1.00
R7691:Herc2 UTSW 7 56191845 missense probably benign
R7733:Herc2 UTSW 7 56188664 missense probably damaging 0.99
R7767:Herc2 UTSW 7 56228527 missense probably benign 0.39
R7802:Herc2 UTSW 7 56164090 missense probably damaging 1.00
R7847:Herc2 UTSW 7 56157560 critical splice donor site probably null
R7930:Herc2 UTSW 7 56157560 critical splice donor site probably null
R8003:Herc2 UTSW 7 56168904 missense not run
R8045:Herc2 UTSW 7 56184900 missense not run
RF024:Herc2 UTSW 7 56226525 missense probably damaging 1.00
X0011:Herc2 UTSW 7 56131292 missense probably benign
X0023:Herc2 UTSW 7 56090918 missense possibly damaging 0.73
X0057:Herc2 UTSW 7 56229690 missense probably benign 0.04
X0064:Herc2 UTSW 7 56191211 missense probably benign 0.01
X0064:Herc2 UTSW 7 56191258 missense probably benign
Z1088:Herc2 UTSW 7 56131292 missense probably benign
Z1088:Herc2 UTSW 7 56215381 missense possibly damaging 0.86
Z1088:Herc2 UTSW 7 56215432 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56226589 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56087341 missense probably benign 0.00
Z1176:Herc2 UTSW 7 56097533 missense not run
Z1176:Herc2 UTSW 7 56131292 missense probably benign
Z1176:Herc2 UTSW 7 56132498 missense not run
Z1177:Herc2 UTSW 7 56121589 missense not run
Z1177:Herc2 UTSW 7 56131292 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGACCTGATGTTTCAAGGTG -3'
(R):5'- CAGGCTACATCAGTTGCTAAGC -3'

Sequencing Primer
(F):5'- TCAAGGTGGGGCTAGCTCTC -3'
(R):5'- CTGCTCTAGGAAGAAGTCAGTTACC -3'
Posted On2016-06-21