Incidental Mutation 'R5155:Sez6l2'
ID396663
Institutional Source Beutler Lab
Gene Symbol Sez6l2
Ensembl Gene ENSMUSG00000030683
Gene Nameseizure related 6 homolog like 2
SynonymsPsk1
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126950563-126970606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126962373 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 472 (S472P)
Ref Sequence ENSEMBL: ENSMUSP00000101939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000146017]
Predicted Effect probably damaging
Transcript: ENSMUST00000106332
AA Change: S472P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683
AA Change: S472P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
CUB 113 226 8.25e-4 SMART
CCP 230 285 3.75e-15 SMART
CUB 289 399 1.3e-3 SMART
CCP 404 463 8.9e-8 SMART
CUB 467 578 3.45e-14 SMART
CCP 584 639 1.18e-12 SMART
CCP 645 704 1.31e-14 SMART
CCP 711 768 2.76e-13 SMART
transmembrane domain 798 820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106333
AA Change: S532P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683
AA Change: S532P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 858 880 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106335
AA Change: S532P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683
AA Change: S532P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 845 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125669
Predicted Effect probably benign
Transcript: ENSMUST00000146017
SMART Domains Protein: ENSMUSP00000115905
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 72 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Sez6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Sez6l2 APN 7 126961883 missense possibly damaging 0.91
IGL01710:Sez6l2 APN 7 126968216 missense probably damaging 1.00
IGL02439:Sez6l2 APN 7 126968189 missense probably damaging 0.99
IGL02752:Sez6l2 APN 7 126953733 missense probably damaging 1.00
H8786:Sez6l2 UTSW 7 126961783 missense possibly damaging 0.95
R0783:Sez6l2 UTSW 7 126967145 missense possibly damaging 0.65
R0989:Sez6l2 UTSW 7 126959844 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1493:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1509:Sez6l2 UTSW 7 126963363 missense probably damaging 1.00
R1704:Sez6l2 UTSW 7 126958341 missense probably damaging 1.00
R1817:Sez6l2 UTSW 7 126967119 missense probably damaging 1.00
R1889:Sez6l2 UTSW 7 126953496 missense probably damaging 1.00
R2509:Sez6l2 UTSW 7 126953772 missense probably benign 0.31
R3772:Sez6l2 UTSW 7 126959203 missense probably damaging 0.99
R4466:Sez6l2 UTSW 7 126959851 missense probably damaging 0.97
R4869:Sez6l2 UTSW 7 126961842 missense probably benign 0.02
R5416:Sez6l2 UTSW 7 126961886 missense probably damaging 1.00
R5551:Sez6l2 UTSW 7 126966830 missense probably damaging 1.00
R5884:Sez6l2 UTSW 7 126970156 unclassified probably benign
R5903:Sez6l2 UTSW 7 126970133 unclassified probably benign
R6015:Sez6l2 UTSW 7 126953453 missense probably damaging 0.97
R6726:Sez6l2 UTSW 7 126968005 missense probably damaging 0.96
R7094:Sez6l2 UTSW 7 126952924 missense probably damaging 0.99
R7117:Sez6l2 UTSW 7 126953743 missense possibly damaging 0.94
R7228:Sez6l2 UTSW 7 126953725 missense probably damaging 1.00
R7479:Sez6l2 UTSW 7 126963659 missense probably damaging 1.00
R7502:Sez6l2 UTSW 7 126961743 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTAGCTGAGTGCAGGGCTAG -3'
(R):5'- CCCAAGGAATTCTGTGTGAGC -3'

Sequencing Primer
(F):5'- GAGAAGCAACCATAATAAAACCTGG -3'
(R):5'- CTCAGAATGCAGGCTAGTGC -3'
Posted On2016-06-21