Incidental Mutation 'R5155:Cc2d1a'
ID396665
Institutional Source Beutler Lab
Gene Symbol Cc2d1a
Ensembl Gene ENSMUSG00000036686
Gene Namecoiled-coil and C2 domain containing 1A
SynonymsFreud-1, Tape
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84132828-84147936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84141126 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 224 (H224Q)
Ref Sequence ENSEMBL: ENSMUSP00000112556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000117424]
Predicted Effect probably benign
Transcript: ENSMUST00000040383
AA Change: H269Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: H269Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117424
AA Change: H224Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: H224Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154029
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Cc2d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Cc2d1a APN 8 84140265 missense possibly damaging 0.87
IGL01126:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01129:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01133:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01135:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01953:Cc2d1a APN 8 84143978 missense probably benign 0.00
IGL02216:Cc2d1a APN 8 84139313 nonsense probably null
IGL03131:Cc2d1a APN 8 84143427 missense probably damaging 1.00
IGL03268:Cc2d1a APN 8 84133525 missense probably damaging 1.00
IGL03401:Cc2d1a APN 8 84134629 missense probably benign 0.00
R0313:Cc2d1a UTSW 8 84136969 missense probably benign 0.38
R0811:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0812:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0893:Cc2d1a UTSW 8 84140839 splice site probably benign
R1440:Cc2d1a UTSW 8 84133975 critical splice donor site probably null
R1625:Cc2d1a UTSW 8 84139372 missense probably damaging 1.00
R2183:Cc2d1a UTSW 8 84140399 missense probably damaging 1.00
R5959:Cc2d1a UTSW 8 84133503 nonsense probably null
R6046:Cc2d1a UTSW 8 84136942 missense possibly damaging 0.81
R6386:Cc2d1a UTSW 8 84138537 missense probably damaging 0.96
R6956:Cc2d1a UTSW 8 84135899 missense probably damaging 1.00
R6992:Cc2d1a UTSW 8 84134913 missense probably damaging 1.00
R7156:Cc2d1a UTSW 8 84135760 missense possibly damaging 0.69
R7396:Cc2d1a UTSW 8 84143745 splice site probably null
R7456:Cc2d1a UTSW 8 84140239 critical splice donor site probably null
R7787:Cc2d1a UTSW 8 84133515 missense possibly damaging 0.94
RF007:Cc2d1a UTSW 8 84134669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATACTGGGACACTGCTAG -3'
(R):5'- GTAGCTTCCCCAAACCTCCATG -3'

Sequencing Primer
(F):5'- TGCTAGCTGGCAGAGGATG -3'
(R):5'- TCATGCTACTGGACAGCTGAG -3'
Posted On2016-06-21