Mutagenetix > Incidental Mutations

Incidental Mutation 'R5155:Adamts8'

396667

Institutional Source

Beutler Lab

Gene Symbol

Adamts8

Ensembl Gene

ENSMUSG00000031994

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8

Synonyms

METH-2, METH2

MMRRC Submission

042737-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30942562-30963838 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30954548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 464 (D464G)

Ref Sequence

ENSEMBL: ENSMUSP00000069644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068135
AA Change: D464G

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: D464G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	152	6.4e-23	PFAM
Pfam:Reprolysin_5	232	418	1.3e-15	PFAM
Pfam:Reprolysin_4	233	435	3.4e-8	PFAM
Pfam:Reprolysin	234	444	3.8e-21	PFAM
Pfam:Reprolysin_2	252	434	1.3e-10	PFAM
Pfam:Reprolysin_3	255	389	7.4e-14	PFAM
TSP1	545	597	7.04e-14	SMART
Pfam:ADAM_spacer1	706	825	3.2e-35	PFAM
TSP1	851	904	5.35e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163037

SMART Domains

Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

Domain	Start	End	E-Value	Type
PDB:2V4B\|B	22	128	2e-38	PDB
SCOP:d1kufa_	27	128	2e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214688

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Adamts8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Adamts8	APN	9	30953500	missense	probably damaging	1.00
IGL02049:Adamts8	APN	9	30951354	missense	probably damaging	0.96
IGL02304:Adamts8	APN	9	30956656	missense	possibly damaging	0.55
IGL02385:Adamts8	APN	9	30961730	missense	probably benign	0.10
IGL02536:Adamts8	APN	9	30962072	missense	probably benign	0.05
IGL03347:Adamts8	APN	9	30959238	missense	possibly damaging	0.75
R0633:Adamts8	UTSW	9	30943511	missense	probably damaging	1.00
R1066:Adamts8	UTSW	9	30956541	missense	probably damaging	1.00
R1464:Adamts8	UTSW	9	30951377	missense	probably benign
R1464:Adamts8	UTSW	9	30951377	missense	probably benign
R1560:Adamts8	UTSW	9	30956667	missense	probably damaging	1.00
R1592:Adamts8	UTSW	9	30943176	missense	probably damaging	0.99
R1753:Adamts8	UTSW	9	30954614	missense	probably benign	0.04
R1932:Adamts8	UTSW	9	30956512	missense	probably benign
R2087:Adamts8	UTSW	9	30962112	missense	probably damaging	1.00
R2118:Adamts8	UTSW	9	30943063	missense	probably damaging	1.00
R3789:Adamts8	UTSW	9	30959292	missense	probably damaging	1.00
R4165:Adamts8	UTSW	9	30951388	missense	probably benign	0.01
R4166:Adamts8	UTSW	9	30951388	missense	probably benign	0.01
R4193:Adamts8	UTSW	9	30959308	missense	probably damaging	1.00
R4425:Adamts8	UTSW	9	30956656	missense	possibly damaging	0.55
R5433:Adamts8	UTSW	9	30961716	missense	probably benign	0.01
R5544:Adamts8	UTSW	9	30952703	missense	probably damaging	1.00
R5590:Adamts8	UTSW	9	30951336	missense	probably damaging	0.97
R5640:Adamts8	UTSW	9	30956500	missense	probably benign	0.00
R5800:Adamts8	UTSW	9	30954482	missense	probably damaging	1.00
R5909:Adamts8	UTSW	9	30961928	missense	probably benign	0.00
R6821:Adamts8	UTSW	9	30956626	missense	probably benign	0.08
R6967:Adamts8	UTSW	9	30954491	missense	probably benign	0.04
R7336:Adamts8	UTSW	9	30962067	missense	probably benign	0.00
R7538:Adamts8	UTSW	9	30953470	missense	probably damaging	1.00
R7540:Adamts8	UTSW	9	30959064	missense	probably damaging	0.96
R7942:Adamts8	UTSW	9	30953482	missense	probably damaging	1.00
R7942:Adamts8	UTSW	9	30958913	critical splice acceptor site	probably null
R8085:Adamts8	UTSW	9	30943315	missense	probably benign	0.01
R8795:Adamts8	UTSW	9	30943188	missense	probably benign	0.00
R8877:Adamts8	UTSW	9	30951392	missense	probably damaging	1.00
R8900:Adamts8	UTSW	9	30954634	missense	probably benign	0.01
R9141:Adamts8	UTSW	9	30953425	missense	possibly damaging	0.72
R9224:Adamts8	UTSW	9	30942892	missense	probably benign	0.18
R9326:Adamts8	UTSW	9	30943590	missense	probably benign
R9331:Adamts8	UTSW	9	30951474	missense	probably damaging	1.00
R9426:Adamts8	UTSW	9	30953425	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CTGGGATGCCTAAACACCAAAG -3'
(R):5'- GAGTACACAGCTACCATCCAGG -3'

Sequencing Primer
(F):5'- CACCAAAGTGTATCATTCAGAATTGG -3'
(R):5'- TACCATCCAGGCACAGGTG -3'

Posted On

2016-06-21