Mutagenetix > Incidental Mutations

Incidental Mutation 'R5155:Scaper'

396668

Institutional Source

Beutler Lab

Gene Symbol

Scaper

Ensembl Gene

ENSMUSG00000034007

Gene Name

S phase cyclin A-associated protein in the ER

Synonyms

D530014O03Rik, Zfp291

MMRRC Submission

042737-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.728) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55549879-55938119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55556086 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 854 (Q854L)

Ref Sequence

ENSEMBL: ENSMUSP00000149836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000037408] [ENSMUST00000216595] [ENSMUST00000217647] [ENSMUST00000214747]

Predicted Effect

probably null
Transcript: ENSMUST00000037408
AA Change: Q1347L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: Q1347L

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000037408
AA Change: Q1347L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: Q1347L

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082538

Predicted Effect

probably null
Transcript: ENSMUST00000216595
AA Change: Q854L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably null
Transcript: ENSMUST00000217647
AA Change: Q1347L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably null
Transcript: ENSMUST00000214747
AA Change: Q1341L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Scaper

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Scaper	APN	9	55859859	missense	probably damaging	0.99
IGL00912:Scaper	APN	9	55685955	missense	probably damaging	1.00
IGL01469:Scaper	APN	9	55859767	missense	probably damaging	1.00
IGL01626:Scaper	APN	9	55912051	missense	possibly damaging	0.61
IGL01779:Scaper	APN	9	55892240	missense	probably benign	0.20
IGL02011:Scaper	APN	9	55580322	missense	probably damaging	1.00
IGL02997:Scaper	APN	9	55815499	missense	probably damaging	1.00
IGL03107:Scaper	APN	9	55858402	splice site	probably benign
IGL03167:Scaper	APN	9	55859824	missense	probably damaging	1.00
IGL03293:Scaper	APN	9	55874823	missense	probably benign
IGL03340:Scaper	APN	9	55602832	missense	possibly damaging	0.88
IGL03368:Scaper	APN	9	55656027	missense	possibly damaging	0.53
R0111:Scaper	UTSW	9	55602790	missense	probably benign	0.01
R0510:Scaper	UTSW	9	55758062	splice site	probably benign
R0531:Scaper	UTSW	9	55609874	missense	possibly damaging	0.91
R0558:Scaper	UTSW	9	55685923	missense	probably benign	0.08
R0605:Scaper	UTSW	9	55815518	splice site	probably benign
R0646:Scaper	UTSW	9	55758056	missense	probably damaging	1.00
R0837:Scaper	UTSW	9	55859042	nonsense	probably null
R1440:Scaper	UTSW	9	55602918	nonsense	probably null
R1548:Scaper	UTSW	9	55816670	missense	probably damaging	1.00
R1777:Scaper	UTSW	9	55864546	missense	probably benign	0.33
R1822:Scaper	UTSW	9	55859900	missense	probably damaging	0.99
R1834:Scaper	UTSW	9	55816734	missense	possibly damaging	0.90
R1870:Scaper	UTSW	9	55685938	missense	probably damaging	1.00
R2102:Scaper	UTSW	9	55912050	missense	probably benign	0.43
R2168:Scaper	UTSW	9	55743639	missense	probably damaging	1.00
R2174:Scaper	UTSW	9	55859037	missense	probably null	0.01
R3690:Scaper	UTSW	9	55883921	missense	probably benign	0.00
R4392:Scaper	UTSW	9	55858115	missense	probably damaging	0.99
R4418:Scaper	UTSW	9	55838180	missense	probably damaging	1.00
R4606:Scaper	UTSW	9	55655903	critical splice donor site	probably null
R4643:Scaper	UTSW	9	55838179	missense	probably damaging	0.99
R4665:Scaper	UTSW	9	55912055	missense	probably damaging	1.00
R4739:Scaper	UTSW	9	55743648	missense	probably damaging	1.00
R4921:Scaper	UTSW	9	55892235	missense	probably benign	0.02
R4934:Scaper	UTSW	9	55809175	missense	probably damaging	1.00
R4956:Scaper	UTSW	9	55838142	missense	probably damaging	1.00
R5055:Scaper	UTSW	9	55859719	splice site	probably null
R5107:Scaper	UTSW	9	55580332	missense	probably damaging	1.00
R5265:Scaper	UTSW	9	55864546	missense	probably benign
R5408:Scaper	UTSW	9	55586224	missense	probably damaging	0.99
R5623:Scaper	UTSW	9	55864507	missense	probably benign	0.02
R5665:Scaper	UTSW	9	55807632	missense	probably damaging	1.00
R5748:Scaper	UTSW	9	55859076	critical splice acceptor site	probably null
R5771:Scaper	UTSW	9	55816791	missense	probably damaging	1.00
R6534:Scaper	UTSW	9	55883976	missense	probably benign	0.00
R6557:Scaper	UTSW	9	55550850	missense	probably benign	0.02
R6651:Scaper	UTSW	9	55858504	missense	probably benign	0.05
R6796:Scaper	UTSW	9	55864427	missense	probably benign	0.00
R6962:Scaper	UTSW	9	55859771	missense	probably benign	0.01
R7145:Scaper	UTSW	9	55912111	missense	unknown
R7199:Scaper	UTSW	9	55838176	nonsense	probably null
R7356:Scaper	UTSW	9	55892211	missense	unknown
R7426:Scaper	UTSW	9	55762277	nonsense	probably null
R7503:Scaper	UTSW	9	55807754	missense	probably damaging	0.98
R7844:Scaper	UTSW	9	55815448	missense	probably benign	0.04
R7966:Scaper	UTSW	9	55762327	missense	probably damaging	0.98
R7992:Scaper	UTSW	9	55858154	missense	probably benign	0.02
R8081:Scaper	UTSW	9	55916046	missense	unknown
R8189:Scaper	UTSW	9	55912120	missense	probably damaging	1.00
R8294:Scaper	UTSW	9	55609996	missense	possibly damaging	0.62
R8351:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8451:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8473:Scaper	UTSW	9	55550847	missense	probably damaging	1.00
R8476:Scaper	UTSW	9	55762291	missense	probably damaging	1.00
R8504:Scaper	UTSW	9	55864438	missense	probably benign
X0012:Scaper	UTSW	9	55655930	missense	probably damaging	0.98
X0052:Scaper	UTSW	9	55816664	missense	probably damaging	1.00
Z1176:Scaper	UTSW	9	55556248	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACTCCTCTGGGCAGAAG -3'
(R):5'- ACGGTCTCCTGCTCTGTTGTAG -3'

Sequencing Primer
(F):5'- ACTCCTCTGGGCAGAAGCATTC -3'
(R):5'- ATTGTTCAGTCCGGCCG -3'

Posted On

2016-06-21