Mutagenetix > Incidental Mutation

Incidental Mutation 'R5155:Clstn2'

396670

Institutional Source

Beutler Lab

Gene Symbol

Clstn2

Ensembl Gene

ENSMUSG00000032452

Gene Name

calsyntenin 2

Synonyms

Cst-2, CSTN2, CS2, 2900042C18Rik

MMRRC Submission

042737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97444395-98033181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 97456431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 892 (M892L)

Ref Sequence

ENSEMBL: ENSMUSP00000124081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]

AlphaFold

Q9ER65

Predicted Effect

probably benign
Transcript: ENSMUST00000035027
AA Change: M892L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: M892L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
SCOP:d1a8d_1	358	538	5e-21	SMART
Blast:LamG	380	529	3e-41	BLAST
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162295
AA Change: M892L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: M892L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
Pfam:Laminin_G_3	356	533	1.4e-9	PFAM
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Clstn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Clstn2	APN	9	97582452	splice site	probably benign
IGL00563:Clstn2	APN	9	97582452	splice site	probably benign
IGL00733:Clstn2	APN	9	97483049	missense	probably damaging	1.00
IGL01303:Clstn2	APN	9	97483075	nonsense	probably null
IGL01935:Clstn2	APN	9	97463468	missense	probably damaging	1.00
IGL02157:Clstn2	APN	9	97541875	missense	probably benign
IGL02974:Clstn2	APN	9	97532707	missense	probably damaging	1.00
IGL03164:Clstn2	APN	9	97799409	missense	possibly damaging	0.50
IGL03298:Clstn2	APN	9	97456572	missense	probably damaging	1.00
R0653:Clstn2	UTSW	9	97458204	missense	probably damaging	1.00
R0845:Clstn2	UTSW	9	97570628	missense	probably benign	0.39
R0992:Clstn2	UTSW	9	97445712	missense	probably benign	0.00
R1105:Clstn2	UTSW	9	97583499	splice site	probably null
R1112:Clstn2	UTSW	9	97458228	missense	possibly damaging	0.92
R1264:Clstn2	UTSW	9	97457609	missense	probably benign	0.28
R1275:Clstn2	UTSW	9	97457430	missense	probably benign	0.00
R1329:Clstn2	UTSW	9	97458174	missense	probably damaging	1.00
R1396:Clstn2	UTSW	9	97461393	missense	probably benign	0.02
R1556:Clstn2	UTSW	9	97456505	missense	probably benign	0.41
R1703:Clstn2	UTSW	9	97458237	missense	possibly damaging	0.90
R1837:Clstn2	UTSW	9	97583540	missense	probably benign	0.00
R2911:Clstn2	UTSW	9	97532722	missense	probably damaging	1.00
R3434:Clstn2	UTSW	9	97454715	missense	probably benign	0.17
R3771:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3772:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3854:Clstn2	UTSW	9	97463595	nonsense	probably null
R4049:Clstn2	UTSW	9	97457560	missense	possibly damaging	0.59
R4334:Clstn2	UTSW	9	97463528	missense	probably damaging	1.00
R4705:Clstn2	UTSW	9	97463559	missense	possibly damaging	0.95
R4755:Clstn2	UTSW	9	97445673	missense	probably benign	0.01
R4884:Clstn2	UTSW	9	97799395	missense	probably damaging	1.00
R5017:Clstn2	UTSW	9	97483086	missense	probably damaging	1.00
R5076:Clstn2	UTSW	9	97483079	missense	probably damaging	1.00
R5122:Clstn2	UTSW	9	97461421	missense	probably damaging	1.00
R5560:Clstn2	UTSW	9	97469819	missense	possibly damaging	0.95
R6009:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6011:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6029:Clstn2	UTSW	9	97456581	missense	probably benign	0.00
R6093:Clstn2	UTSW	9	97458210	missense	probably damaging	1.00
R6284:Clstn2	UTSW	9	97454674	missense	probably benign
R6676:Clstn2	UTSW	9	97461531	missense	probably damaging	1.00
R6902:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6946:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6966:Clstn2	UTSW	9	97526406	nonsense	probably null
R7329:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7330:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7382:Clstn2	UTSW	9	97799398	nonsense	probably null
R7410:Clstn2	UTSW	9	97541867	missense	probably benign	0.06
R7549:Clstn2	UTSW	9	97582544	missense	probably benign	0.01
R7879:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R8070:Clstn2	UTSW	9	97799470	missense	possibly damaging	0.79
R8193:Clstn2	UTSW	9	97583630	missense	probably damaging	1.00
R8422:Clstn2	UTSW	9	97458186	missense	probably benign	0.39
R9190:Clstn2	UTSW	9	97532762	missense	probably damaging	1.00
R9221:Clstn2	UTSW	9	97461342	missense	probably benign	0.00
R9305:Clstn2	UTSW	9	97461484	missense	probably damaging	1.00
R9347:Clstn2	UTSW	9	97582601	missense	probably damaging	1.00
R9520:Clstn2	UTSW	9	97532710	missense	probably damaging	1.00
R9751:Clstn2	UTSW	9	97457650	missense	probably damaging	0.98
X0027:Clstn2	UTSW	9	97526399	missense	probably damaging	1.00
Z1177:Clstn2	UTSW	9	97461356	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACACATTTACATGAGAGAACACGG -3'
(R):5'- TTGTTTCAGTGGTCCCGAGC -3'

Sequencing Primer
(F):5'- TCACAGAGAAGTATGGCTTGCTC -3'
(R):5'- AGCATCGCCACTGTCGTC -3'

Posted On

2016-06-21