Incidental Mutation 'R5155:Mrps7'
ID396679
Institutional Source Beutler Lab
Gene Symbol Mrps7
Ensembl Gene ENSMUSG00000046756
Gene Namemitchondrial ribosomal protein S7
SynonymsMRP-S7, Rpms7
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115603925-115608036 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115604829 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 64 (Y64*)
Ref Sequence ENSEMBL: ENSMUSP00000053033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021087] [ENSMUST00000058109] [ENSMUST00000106508] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000125097] [ENSMUST00000156173] [ENSMUST00000148574]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000058109
AA Change: Y64*
SMART Domains Protein: ENSMUSP00000053033
Gene: ENSMUSG00000046756
AA Change: Y64*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_S7 68 234 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132503
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158851
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. In the prokaryotic ribosome, the comparable protein is thought to play an essential role in organizing the 3' domain of the 16 S rRNA in the vicinity of the P- and A-sites. Pseudogenes corresponding to this gene are found on chromosomes 8p and 12p. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Mrps7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mrps7 APN 11 115604858 missense possibly damaging 0.78
IGL02928:Mrps7 APN 11 115605084 nonsense probably null
R1494:Mrps7 UTSW 11 115604126 unclassified probably benign
R1501:Mrps7 UTSW 11 115604197 missense probably benign 0.00
R1651:Mrps7 UTSW 11 115604755 nonsense probably null
R1830:Mrps7 UTSW 11 115606985 missense probably benign 0.01
R2895:Mrps7 UTSW 11 115605039 missense probably benign 0.01
R6076:Mrps7 UTSW 11 115604887 missense probably damaging 0.99
R6144:Mrps7 UTSW 11 115604174 missense probably benign 0.43
R6180:Mrps7 UTSW 11 115604881 missense possibly damaging 0.95
R7421:Mrps7 UTSW 11 115604891 missense probably benign 0.22
R7541:Mrps7 UTSW 11 115606870 missense probably damaging 0.97
R7697:Mrps7 UTSW 11 115604875 missense probably benign 0.00
R7981:Mrps7 UTSW 11 115606861 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GTGGAGTCACAGATTCACCC -3'
(R):5'- TTACCTGAGCCATGAGAGACC -3'

Sequencing Primer
(F):5'- CGTAGGGTTCTGTCTGCTTCC -3'
(R):5'- AAAACATGGTTAGCTTTCCCGGG -3'
Posted On2016-06-21