Incidental Mutation 'R5155:Engase'
ID396680
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118481281 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 133 (I133S)
Ref Sequence ENSEMBL: ENSMUSP00000117538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043447] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769] [ENSMUST00000172279]
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect probably benign
Transcript: ENSMUST00000135383
AA Change: I133S

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: I133S

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139813
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153825
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168689
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168785
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172279
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1337:Engase UTSW 11 118482574 missense possibly damaging 0.46
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1515:Engase UTSW 11 118487140 missense possibly damaging 0.53
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4730:Engase UTSW 11 118482922 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense probably damaging 0.98
R7233:Engase UTSW 11 118483001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTGACTGCTCTTGACAG -3'
(R):5'- GCTACCGCTCAATTACAGGAC -3'

Sequencing Primer
(F):5'- TCTTGACAGAAGAGCCTCAGC -3'
(R):5'- GGACCACCCAATGCGTACG -3'
Posted On2016-06-21