Incidental Mutation 'R5155:Pum2'
ID 396683
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Name pumilio RNA-binding family member 2
Synonyms 5730503J23Rik, Pumm2
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5155 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 8674134-8752581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8713572 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000126876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000163730] [ENSMUST00000165293] [ENSMUST00000166965] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000169750] [ENSMUST00000170037] [ENSMUST00000178015]
AlphaFold Q80U58
Predicted Effect probably benign
Transcript: ENSMUST00000020915
AA Change: V243A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111122
AA Change: V243A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111123
AA Change: V243A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163569
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163730
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably benign
Transcript: ENSMUST00000166965
Predicted Effect possibly damaging
Transcript: ENSMUST00000168361
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169089
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169750
AA Change: V243A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126876
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170037
Predicted Effect unknown
Transcript: ENSMUST00000171418
AA Change: V104A
SMART Domains Protein: ENSMUSP00000126616
Gene: ENSMUSG00000020594
AA Change: V104A

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
low complexity region 131 152 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178015
AA Change: V243A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
Plumbat UTSW 12 8728779 critical splice donor site probably null
Pummie UTSW 12 8713906 nonsense probably null
Yorkshire UTSW 12 8728726 nonsense probably null
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8721785 missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R4715:Pum2 UTSW 12 8747272 missense probably damaging 1.00
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
R7135:Pum2 UTSW 12 8728952 missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8713906 nonsense probably null
R7586:Pum2 UTSW 12 8747206 missense probably damaging 1.00
R7683:Pum2 UTSW 12 8728922 missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8713595 missense probably benign 0.00
R7873:Pum2 UTSW 12 8748802 missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R8166:Pum2 UTSW 12 8721739 missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8713456 missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8709454 missense probably damaging 0.99
R8418:Pum2 UTSW 12 8710245 missense possibly damaging 0.87
R8802:Pum2 UTSW 12 8728726 nonsense probably null
R9039:Pum2 UTSW 12 8744430 missense probably damaging 1.00
R9207:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R9366:Pum2 UTSW 12 8733344 missense probably benign 0.02
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTAGTTGAGCGCCTTGG -3'
(R):5'- GTCCTCTGAAAGAGCTATCCAG -3'

Sequencing Primer
(F):5'- TGGCCCTAGTACTAATCCCCCAG -3'
(R):5'- ACATCGCAATTCTCATTAAAAAGC -3'
Posted On 2016-06-21