Incidental Mutation 'R5155:Adssl1'
ID396685
Institutional Source Beutler Lab
Gene Symbol Adssl1
Ensembl Gene ENSMUSG00000011148
Gene Nameadenylosuccinate synthetase like 1
SynonymsAdss
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112620045-112641360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112638208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 366 (I366T)
Ref Sequence ENSEMBL: ENSMUSP00000021726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021726] [ENSMUST00000180015]
PDB Structure
IMP Complex of the Recombinant Mouse-Muscle Adenylosuccinate Synthetase [X-RAY DIFFRACTION]
Recombinant Mouse-Muscle Adenylosuccinate Synthetase [X-RAY DIFFRACTION]
Crystal structure of the recombinant mouse-muscle adenylosuccinate synthetase complexed with 6-phosphoryl-IMP, GDP and Mg [X-RAY DIFFRACTION]
Crystal Structure of the Recombinant Mouse-Muscle Adenylosuccinate Synthetase Complexed with 6-phosphoryl-IMP, GDP and Hadacidin [X-RAY DIFFRACTION]
Crystal Structure of the Mouse-Muscle Adenylosuccinate Synthetase Ligated with GTP [X-RAY DIFFRACTION]
Structure of the Recombinant Mouse-Muscle Adenylosuccinate Synthetase Complexed with SAMP, GDP, SO4(2-), and Mg(2+) [X-RAY DIFFRACTION]
Structure of the Recombinant Mouse-Muscle Adenylosuccinate Synthetase Complexed with AMP, GDP, HPO4(2-), and Mg(2+) [X-RAY DIFFRACTION]
Structure of the Recombinant Mouse-Muscle Adenylosuccinate Synthetase Complexed with AMP [X-RAY DIFFRACTION]
Mouse Muscle Adenylosuccinate Synthetase partially ligated complex with GTP, 2'-deoxy-IMP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021726
AA Change: I366T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021726
Gene: ENSMUSG00000011148
AA Change: I366T

DomainStartEndE-ValueType
Adenylsucc_synt 33 455 5.9e-259 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180015
AA Change: I389T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136572
Gene: ENSMUSG00000011148
AA Change: I389T

DomainStartEndE-ValueType
Adenylsucc_synt 33 478 2.17e-248 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221720
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Spsb3 T C 17: 24,886,995 probably benign Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Adssl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Adssl1 APN 12 112634736 splice site probably benign
IGL03105:Adssl1 APN 12 112632721 missense probably benign 0.00
barty UTSW 12 112634189 missense probably damaging 1.00
lannister UTSW 12 112634713 missense probably damaging 1.00
R0179:Adssl1 UTSW 12 112632269 missense probably benign 0.11
R1722:Adssl1 UTSW 12 112636481 missense possibly damaging 0.93
R1911:Adssl1 UTSW 12 112633009 missense probably benign
R2877:Adssl1 UTSW 12 112634189 missense probably damaging 1.00
R4829:Adssl1 UTSW 12 112634713 missense probably damaging 1.00
R6225:Adssl1 UTSW 12 112634403 missense probably damaging 0.96
R6247:Adssl1 UTSW 12 112628356 missense probably damaging 1.00
R6873:Adssl1 UTSW 12 112632704 missense probably benign 0.00
R7012:Adssl1 UTSW 12 112634236 missense probably benign 0.01
R7449:Adssl1 UTSW 12 112634151 missense probably damaging 1.00
R7662:Adssl1 UTSW 12 112639738 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGATTTCAGCAATGCAGATGC -3'
(R):5'- CAGGAATGCCTCTCCTAGTCAC -3'

Sequencing Primer
(F):5'- GGCAGTCCTCTAGCCTGTTCAG -3'
(R):5'- TCTCCTAGTCACCTAGAAACTAGTGG -3'
Posted On2016-06-21