Mutagenetix > Incidental Mutations

Incidental Mutation 'R5155:Itga1'

396689

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

042737-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.420) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115035303 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 89 (S89T)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673] [ENSMUST00000224495]

Predicted Effect

probably benign
Transcript: ENSMUST00000061673
AA Change: S89T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: S89T

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224268

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224493

Predicted Effect

probably benign
Transcript: ENSMUST00000224495

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224865

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Brwd1	G	T	16: 96,002,793	S2524*	probably null	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTATGGCTGTTTCCTGATGAGTTAC -3'
(R):5'- GAGCAAACGTCGACTGTCTTAG -3'

Sequencing Primer
(F):5'- AATAAATTAAGGACTGAGTGAGACAC -3'
(R):5'- ACGTCGACTGTCTTAGAATTTACC -3'

Posted On

2016-06-21