Mutagenetix > Incidental Mutations

Incidental Mutation 'R5155:Brwd1'

396695

Institutional Source

Beutler Lab

Gene Symbol

Brwd1

Ensembl Gene

ENSMUSG00000022914

Gene Name

bromodomain and WD repeat domain containing 1

Synonyms

G1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9

MMRRC Submission

042737-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95992092-96082428 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 96002793 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 2524 (S2524*)

Ref Sequence

ENSEMBL: ENSMUSP00000117066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000153398]

AlphaFold

Q921C3

Predicted Effect

probably null
Transcript: ENSMUST00000023631
AA Change: S2059*

SMART Domains

Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: S2059*

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
WD40	175	214	1.3e-7	SMART
WD40	217	256	2.26e-7	SMART
WD40	259	302	1.83e-7	SMART
WD40	311	352	3.82e1	SMART
WD40	357	396	4.27e-8	SMART
WD40	417	454	8.59e-1	SMART
WD40	457	497	1.47e-6	SMART
WD40	504	544	9.21e0	SMART
low complexity region	660	676	N/A	INTRINSIC
low complexity region	753	767	N/A	INTRINSIC
low complexity region	852	868	N/A	INTRINSIC
low complexity region	906	927	N/A	INTRINSIC
BROMO	1156	1267	1.72e-6	SMART
low complexity region	1277	1292	N/A	INTRINSIC
BROMO	1317	1422	2.65e-30	SMART
low complexity region	1497	1513	N/A	INTRINSIC
low complexity region	1543	1558	N/A	INTRINSIC
internal_repeat_1	1574	1762	1.42e-9	PROSPERO
low complexity region	1764	1775	N/A	INTRINSIC
internal_repeat_1	1857	2050	1.42e-9	PROSPERO
low complexity region	2165	2174	N/A	INTRINSIC
low complexity region	2260	2270	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099502
AA Change: S2059*

SMART Domains

Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: S2059*

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
WD40	175	214	1.3e-7	SMART
WD40	217	256	2.26e-7	SMART
WD40	259	302	1.83e-7	SMART
WD40	311	352	3.82e1	SMART
WD40	357	396	4.27e-8	SMART
WD40	417	454	8.59e-1	SMART
WD40	457	497	1.47e-6	SMART
WD40	504	544	9.21e0	SMART
low complexity region	660	676	N/A	INTRINSIC
low complexity region	753	767	N/A	INTRINSIC
low complexity region	852	868	N/A	INTRINSIC
low complexity region	906	927	N/A	INTRINSIC
BROMO	1156	1267	1.72e-6	SMART
low complexity region	1277	1292	N/A	INTRINSIC
BROMO	1317	1422	2.65e-30	SMART
low complexity region	1497	1513	N/A	INTRINSIC
low complexity region	1543	1558	N/A	INTRINSIC
internal_repeat_1	1574	1762	1.42e-9	PROSPERO
low complexity region	1764	1775	N/A	INTRINSIC
internal_repeat_1	1857	2050	1.42e-9	PROSPERO
low complexity region	2165	2174	N/A	INTRINSIC
low complexity region	2260	2270	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113829
AA Change: S2059*

SMART Domains

Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: S2059*

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
WD40	175	214	1.3e-7	SMART
WD40	217	256	2.26e-7	SMART
WD40	259	302	1.83e-7	SMART
WD40	311	352	3.82e1	SMART
WD40	357	396	4.27e-8	SMART
WD40	417	454	8.59e-1	SMART
WD40	457	497	1.47e-6	SMART
WD40	504	544	9.21e0	SMART
low complexity region	660	676	N/A	INTRINSIC
low complexity region	753	767	N/A	INTRINSIC
low complexity region	852	868	N/A	INTRINSIC
low complexity region	906	927	N/A	INTRINSIC
BROMO	1156	1267	1.72e-6	SMART
low complexity region	1277	1292	N/A	INTRINSIC
BROMO	1317	1422	2.65e-30	SMART
low complexity region	1497	1513	N/A	INTRINSIC
low complexity region	1543	1558	N/A	INTRINSIC
internal_repeat_1	1574	1762	1.13e-9	PROSPERO
low complexity region	1764	1775	N/A	INTRINSIC
internal_repeat_1	1857	2050	1.13e-9	PROSPERO
low complexity region	2165	2174	N/A	INTRINSIC
low complexity region	2177	2188	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000153398
AA Change: S2524*

SMART Domains

Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: S2524*

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
WD40	175	214	1.3e-7	SMART
WD40	217	256	2.26e-7	SMART
WD40	259	302	1.83e-7	SMART
WD40	311	352	3.82e1	SMART
WD40	357	396	4.27e-8	SMART
WD40	417	454	8.59e-1	SMART
WD40	457	497	1.47e-6	SMART
WD40	504	544	9.21e0	SMART
low complexity region	660	676	N/A	INTRINSIC
low complexity region	753	767	N/A	INTRINSIC
low complexity region	852	868	N/A	INTRINSIC
low complexity region	906	927	N/A	INTRINSIC
BROMO	1156	1267	1.72e-6	SMART
low complexity region	1277	1292	N/A	INTRINSIC
BROMO	1317	1422	2.65e-30	SMART
internal_repeat_1	1491	1957	1.45e-251	PROSPERO
internal_repeat_1	1956	2422	1.45e-251	PROSPERO
low complexity region	2630	2639	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156622

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157037

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	C	5: 107,490,703	I323T	probably damaging	Het
Abca13	T	C	11: 9,532,447	V4326A	probably damaging	Het
Actn4	A	G	7: 28,962,017		probably null	Het
Adamts8	A	G	9: 30,954,548	D464G	probably benign	Het
Adssl1	T	C	12: 112,638,208	I366T	probably damaging	Het
Alox12e	T	C	11: 70,316,255	D575G	possibly damaging	Het
Ankrd44	A	T	1: 54,778,330	M73K	probably benign	Het
Ap4e1	A	G	2: 127,063,369	T987A	probably benign	Het
Banp	A	C	8: 122,001,020	S318R	probably damaging	Het
Bcas1	T	C	2: 170,418,618	H47R	probably damaging	Het
Cand2	T	A	6: 115,792,258	D676E	probably benign	Het
Cc2d1a	A	T	8: 84,141,126	H224Q	probably benign	Het
Ccdc138	A	T	10: 58,507,572	Y83F	probably benign	Het
Ccdc155	C	A	7: 45,189,654	E53*	probably null	Het
Ccdc162	A	T	10: 41,553,580		probably null	Het
Ccdc162	A	C	10: 41,579,151	S396A	probably damaging	Het
Ces1e	A	T	8: 93,201,406	*562R	probably null	Het
Clstn2	T	A	9: 97,456,431	M892L	probably benign	Het
Crybg3	T	C	16: 59,524,901	T2673A	possibly damaging	Het
Cstf3	A	G	2: 104,652,485	N326S	probably benign	Het
Cux1	G	A	5: 136,565,441		probably benign	Het
Cyb5r4	T	G	9: 87,040,403	M155R	probably benign	Het
D130043K22Rik	A	G	13: 24,872,290	D535G	probably damaging	Het
D430042O09Rik	A	G	7: 125,872,184	T1486A	probably damaging	Het
Dnah2	G	A	11: 69,422,536	P4266S	probably damaging	Het
Dnah7a	T	A	1: 53,643,495	N272I	probably benign	Het
Dsg2	A	G	18: 20,598,658	Y779C	possibly damaging	Het
Eif4g3	T	A	4: 138,126,743	N507K	probably benign	Het
Elavl4	T	C	4: 110,292,636	Q3R	probably null	Het
Engase	T	G	11: 118,481,281	I133S	probably benign	Het
Ercc5	T	C	1: 44,180,622	V1018A	probably damaging	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam8a1	G	A	13: 46,673,562	A270T	probably benign	Het
Fhdc1	T	G	3: 84,446,150	Q589H	probably benign	Het
Gatm	G	A	2: 122,609,853	T35I	probably benign	Het
Gcgr	T	C	11: 120,537,046	I271T	probably benign	Het
Gm21818	T	C	13: 120,173,553	S124P	probably benign	Het
Gm527	T	A	12: 64,923,607	Y239N	probably damaging	Het
H2-Ab1	A	G	17: 34,267,384	H139R	possibly damaging	Het
Herc2	G	A	7: 56,227,826	R4547Q	possibly damaging	Het
Itga1	A	T	13: 115,035,303	S89T	probably benign	Het
Lrba	A	G	3: 86,351,300	M1365V	probably benign	Het
Lrp1b	A	C	2: 41,728,622		probably null	Het
Map1a	G	A	2: 121,302,386	A990T	probably damaging	Het
Micall2	C	A	5: 139,710,231	L784F	probably damaging	Het
Mmp9	T	C	2: 164,949,066		probably null	Het
Mrps7	T	A	11: 115,604,829	Y64*	probably null	Het
Mslnl	C	T	17: 25,738,968	Q62*	probably null	Het
Nfil3	A	G	13: 52,968,580	L96P	probably damaging	Het
Olfr453	A	G	6: 42,744,814	Y259C	probably damaging	Het
Phf3	T	C	1: 30,824,376	D756G	possibly damaging	Het
Plxnd1	C	T	6: 115,958,988		probably null	Het
Prickle4	C	T	17: 47,690,057		probably null	Het
Prr9	T	A	3: 92,123,049	T95S	possibly damaging	Het
Prrc2a	A	G	17: 35,160,091		probably null	Het
Prrt3	A	G	6: 113,497,559		probably null	Het
Psme4	A	T	11: 30,876,806	Y1775F	probably damaging	Het
Pum2	T	C	12: 8,713,572	V243A	possibly damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Rnf8	A	G	17: 29,626,630	Y65C	probably damaging	Het
Rph3a	T	C	5: 120,948,770	T456A	possibly damaging	Het
Scaper	T	A	9: 55,556,086	Q854L	probably null	Het
Sez6l2	T	C	7: 126,962,373	S472P	probably damaging	Het
Spsb3	T	C	17: 24,886,995		probably benign	Het
Srebf2	A	G	15: 82,196,226	D40G	probably damaging	Het
Sspo	A	G	6: 48,460,474	N1389D	probably benign	Het
Taf4b	G	T	18: 14,830,095	A631S	probably benign	Het
Tigd4	G	A	3: 84,594,663	V296M	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,316		probably benign	Het
Uso1	T	A	5: 92,167,335		probably null	Het
Vmn2r6	T	G	3: 64,538,514	N597H	probably benign	Het
Zfc3h1	T	A	10: 115,412,121	S1076R	possibly damaging	Het
Zfp64	T	A	2: 168,906,965	Q44L	probably benign	Het

Other mutations in Brwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Brwd1	APN	16	96017586	missense	probably damaging	1.00
IGL00974:Brwd1	APN	16	96043026	missense	probably damaging	1.00
IGL01014:Brwd1	APN	16	96016173	missense	probably benign	0.04
IGL01447:Brwd1	APN	16	96047379	nonsense	probably null
IGL01459:Brwd1	APN	16	96047420	missense	probably damaging	1.00
IGL01631:Brwd1	APN	16	96046466	missense	probably damaging	1.00
IGL02184:Brwd1	APN	16	96013829	missense	probably damaging	1.00
IGL02264:Brwd1	APN	16	96019456	missense	probably damaging	0.98
IGL02679:Brwd1	APN	16	96002823	missense	probably benign
IGL02833:Brwd1	APN	16	96052571	missense	probably damaging	1.00
IGL02960:Brwd1	APN	16	96057466	missense	probably damaging	1.00
IGL03053:Brwd1	APN	16	96017677	missense	possibly damaging	0.75
IGL03074:Brwd1	APN	16	96011850	missense	probably benign	0.00
IGL03135:Brwd1	APN	16	96021258	missense	probably damaging	0.99
IGL03168:Brwd1	APN	16	96017677	missense	possibly damaging	0.75
IGL03214:Brwd1	APN	16	96037900	missense	probably benign	0.26
IGL03328:Brwd1	APN	16	96002725	missense	probably damaging	0.99
bromide	UTSW	16	96064887	missense	probably damaging	1.00
Embers	UTSW	16	96017604	missense	probably damaging	1.00
Glowing	UTSW	16	96035959	missense	probably damaging	1.00
Soporific	UTSW	16	96033843	nonsense	probably null
G1citation:Brwd1	UTSW	16	96041274	missense	probably benign	0.42
PIT4243001:Brwd1	UTSW	16	96002671	nonsense	probably null
R0012:Brwd1	UTSW	16	96059652	missense	probably damaging	0.98
R0012:Brwd1	UTSW	16	96059652	missense	probably damaging	0.98
R0030:Brwd1	UTSW	16	96021256	missense	probably damaging	1.00
R0135:Brwd1	UTSW	16	96047104	missense	probably damaging	1.00
R0366:Brwd1	UTSW	16	96037964	nonsense	probably null
R0551:Brwd1	UTSW	16	96035974	missense	probably damaging	1.00
R0586:Brwd1	UTSW	16	96043086	missense	probably damaging	1.00
R0865:Brwd1	UTSW	16	96068584	missense	probably damaging	1.00
R1226:Brwd1	UTSW	16	96031548	missense	probably benign	0.35
R1329:Brwd1	UTSW	16	96003234	missense	probably benign	0.07
R1378:Brwd1	UTSW	16	96041370	missense	probably benign	0.06
R1420:Brwd1	UTSW	16	96036034	missense	probably damaging	1.00
R1441:Brwd1	UTSW	16	96066151	missense	probably damaging	0.99
R1484:Brwd1	UTSW	16	96028291	splice site	probably null
R1624:Brwd1	UTSW	16	96008144	missense	possibly damaging	0.67
R1636:Brwd1	UTSW	16	96059641	missense	probably damaging	1.00
R1988:Brwd1	UTSW	16	96021237	missense	probably damaging	0.96
R1998:Brwd1	UTSW	16	96021288	missense	probably damaging	1.00
R2066:Brwd1	UTSW	16	96046465	missense	probably benign	0.01
R2898:Brwd1	UTSW	16	96066100	missense	probably damaging	0.99
R2983:Brwd1	UTSW	16	96066574	missense	probably damaging	0.98
R3966:Brwd1	UTSW	16	96044530	missense	probably damaging	1.00
R4086:Brwd1	UTSW	16	96046372	missense	probably benign	0.03
R4257:Brwd1	UTSW	16	96023496	missense	probably damaging	1.00
R4290:Brwd1	UTSW	16	96017604	missense	probably damaging	1.00
R4292:Brwd1	UTSW	16	96017604	missense	probably damaging	1.00
R4293:Brwd1	UTSW	16	96017604	missense	probably damaging	1.00
R4614:Brwd1	UTSW	16	96047359	missense	probably damaging	1.00
R4771:Brwd1	UTSW	16	96003318	missense	probably benign	0.00
R5025:Brwd1	UTSW	16	96053972	missense	probably damaging	0.97
R5229:Brwd1	UTSW	16	96002209	missense	possibly damaging	0.87
R5246:Brwd1	UTSW	16	96002557	missense	probably damaging	1.00
R5668:Brwd1	UTSW	16	96016150	missense	probably damaging	1.00
R5763:Brwd1	UTSW	16	96033843	nonsense	probably null
R5782:Brwd1	UTSW	16	96043043	nonsense	probably null
R5831:Brwd1	UTSW	16	96019436	missense	probably damaging	1.00
R5836:Brwd1	UTSW	16	96064758	missense	probably damaging	1.00
R5906:Brwd1	UTSW	16	96058738	missense	probably damaging	1.00
R5995:Brwd1	UTSW	16	96064787	missense	probably damaging	1.00
R6143:Brwd1	UTSW	16	96002956	missense	probably benign	0.00
R6241:Brwd1	UTSW	16	96013874	missense	probably damaging	1.00
R6313:Brwd1	UTSW	16	96007941	missense	probably benign	0.01
R6362:Brwd1	UTSW	16	96002307	missense	probably damaging	1.00
R6551:Brwd1	UTSW	16	95993962	missense	possibly damaging	0.55
R6736:Brwd1	UTSW	16	96068572	missense	probably damaging	1.00
R6822:Brwd1	UTSW	16	96041274	missense	probably benign	0.42
R7080:Brwd1	UTSW	16	96009530	missense	probably benign	0.01
R7131:Brwd1	UTSW	16	96066498	missense	probably damaging	1.00
R7208:Brwd1	UTSW	16	96035959	missense	probably damaging	1.00
R7322:Brwd1	UTSW	16	96066119	missense	probably damaging	1.00
R7483:Brwd1	UTSW	16	96056173	missense	probably damaging	0.99
R7615:Brwd1	UTSW	16	96033839	missense	probably damaging	0.96
R7621:Brwd1	UTSW	16	96064887	missense	probably damaging	1.00
R7665:Brwd1	UTSW	16	96041343	missense	probably benign	0.09
R7697:Brwd1	UTSW	16	96046401	missense	probably benign	0.10
R7740:Brwd1	UTSW	16	96027368	missense	probably damaging	1.00
R8120:Brwd1	UTSW	16	96019449	missense	probably benign	0.23
R8187:Brwd1	UTSW	16	96002734	missense	probably damaging	0.98
R8359:Brwd1	UTSW	16	96016209	missense	probably damaging	1.00
R8480:Brwd1	UTSW	16	96047430	missense	probably damaging	0.98
R8511:Brwd1	UTSW	16	96058738	missense	probably damaging	1.00
R9046:Brwd1	UTSW	16	96028202	missense	probably damaging	1.00
R9074:Brwd1	UTSW	16	96023410	missense
R9102:Brwd1	UTSW	16	96068525	missense	probably benign	0.43
R9115:Brwd1	UTSW	16	96047114	missense	probably damaging	1.00
R9130:Brwd1	UTSW	16	96064930	missense	probably damaging	1.00
R9200:Brwd1	UTSW	16	96037954	missense	probably benign	0.00
R9246:Brwd1	UTSW	16	96002816	missense	probably benign	0.00
R9407:Brwd1	UTSW	16	96002493	missense	possibly damaging	0.74
X0017:Brwd1	UTSW	16	96044491	missense	probably damaging	1.00
X0028:Brwd1	UTSW	16	96011923	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ACCATCTACCTCAGGATGCATTC -3'
(R):5'- AGAGAATCCCAGTCAGGCTG -3'

Sequencing Primer
(F):5'- ACCTCAGGATGCATTCTCCTC -3'
(R):5'- ATCCCAGTCAGGCTGCAAGTG -3'

Posted On

2016-06-21