Incidental Mutation 'R5155:Spsb3'
ID396696
Institutional Source Beutler Lab
Gene Symbol Spsb3
Ensembl Gene ENSMUSG00000024160
Gene NamesplA/ryanodine receptor domain and SOCS box containing 3
SynonymsSSB3, Tce1, 3300001M01Rik, 2310012N15Rik
MMRRC Submission 042737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5155 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24886643-24892152 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 24886995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000044252] [ENSMUST00000050714] [ENSMUST00000068508] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000130194] [ENSMUST00000144430] [ENSMUST00000168265]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050714
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168265
AA Change: F106L
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160
AA Change: F106L

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T C 5: 107,490,703 I323T probably damaging Het
Abca13 T C 11: 9,532,447 V4326A probably damaging Het
Actn4 A G 7: 28,962,017 probably null Het
Adamts8 A G 9: 30,954,548 D464G probably benign Het
Adssl1 T C 12: 112,638,208 I366T probably damaging Het
Alox12e T C 11: 70,316,255 D575G possibly damaging Het
Ankrd44 A T 1: 54,778,330 M73K probably benign Het
Ap4e1 A G 2: 127,063,369 T987A probably benign Het
Banp A C 8: 122,001,020 S318R probably damaging Het
Bcas1 T C 2: 170,418,618 H47R probably damaging Het
Brwd1 G T 16: 96,002,793 S2524* probably null Het
Cand2 T A 6: 115,792,258 D676E probably benign Het
Cc2d1a A T 8: 84,141,126 H224Q probably benign Het
Ccdc138 A T 10: 58,507,572 Y83F probably benign Het
Ccdc155 C A 7: 45,189,654 E53* probably null Het
Ccdc162 A T 10: 41,553,580 probably null Het
Ccdc162 A C 10: 41,579,151 S396A probably damaging Het
Ces1e A T 8: 93,201,406 *562R probably null Het
Clstn2 T A 9: 97,456,431 M892L probably benign Het
Crybg3 T C 16: 59,524,901 T2673A possibly damaging Het
Cstf3 A G 2: 104,652,485 N326S probably benign Het
Cux1 G A 5: 136,565,441 probably benign Het
Cyb5r4 T G 9: 87,040,403 M155R probably benign Het
D130043K22Rik A G 13: 24,872,290 D535G probably damaging Het
D430042O09Rik A G 7: 125,872,184 T1486A probably damaging Het
Dnah2 G A 11: 69,422,536 P4266S probably damaging Het
Dnah7a T A 1: 53,643,495 N272I probably benign Het
Dsg2 A G 18: 20,598,658 Y779C possibly damaging Het
Eif4g3 T A 4: 138,126,743 N507K probably benign Het
Elavl4 T C 4: 110,292,636 Q3R probably null Het
Engase T G 11: 118,481,281 I133S probably benign Het
Ercc5 T C 1: 44,180,622 V1018A probably damaging Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam8a1 G A 13: 46,673,562 A270T probably benign Het
Fhdc1 T G 3: 84,446,150 Q589H probably benign Het
Gatm G A 2: 122,609,853 T35I probably benign Het
Gcgr T C 11: 120,537,046 I271T probably benign Het
Gm21818 T C 13: 120,173,553 S124P probably benign Het
Gm527 T A 12: 64,923,607 Y239N probably damaging Het
H2-Ab1 A G 17: 34,267,384 H139R possibly damaging Het
Herc2 G A 7: 56,227,826 R4547Q possibly damaging Het
Itga1 A T 13: 115,035,303 S89T probably benign Het
Lrba A G 3: 86,351,300 M1365V probably benign Het
Lrp1b A C 2: 41,728,622 probably null Het
Map1a G A 2: 121,302,386 A990T probably damaging Het
Micall2 C A 5: 139,710,231 L784F probably damaging Het
Mmp9 T C 2: 164,949,066 probably null Het
Mrps7 T A 11: 115,604,829 Y64* probably null Het
Mslnl C T 17: 25,738,968 Q62* probably null Het
Nfil3 A G 13: 52,968,580 L96P probably damaging Het
Olfr453 A G 6: 42,744,814 Y259C probably damaging Het
Phf3 T C 1: 30,824,376 D756G possibly damaging Het
Plxnd1 C T 6: 115,958,988 probably null Het
Prickle4 C T 17: 47,690,057 probably null Het
Prr9 T A 3: 92,123,049 T95S possibly damaging Het
Prrc2a A G 17: 35,160,091 probably null Het
Prrt3 A G 6: 113,497,559 probably null Het
Psme4 A T 11: 30,876,806 Y1775F probably damaging Het
Pum2 T C 12: 8,713,572 V243A possibly damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Rnf8 A G 17: 29,626,630 Y65C probably damaging Het
Rph3a T C 5: 120,948,770 T456A possibly damaging Het
Scaper T A 9: 55,556,086 Q854L probably null Het
Sez6l2 T C 7: 126,962,373 S472P probably damaging Het
Srebf2 A G 15: 82,196,226 D40G probably damaging Het
Sspo A G 6: 48,460,474 N1389D probably benign Het
Taf4b G T 18: 14,830,095 A631S probably benign Het
Tigd4 G A 3: 84,594,663 V296M possibly damaging Het
Tsc22d2 T A 3: 58,417,316 probably benign Het
Uso1 T A 5: 92,167,335 probably null Het
Vmn2r6 T G 3: 64,538,514 N597H probably benign Het
Zfc3h1 T A 10: 115,412,121 S1076R possibly damaging Het
Zfp64 T A 2: 168,906,965 Q44L probably benign Het
Other mutations in Spsb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Spsb3 APN 17 24890565 splice site probably benign
IGL03225:Spsb3 APN 17 24891071 missense possibly damaging 0.90
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0071:Spsb3 UTSW 17 24887904 missense probably damaging 1.00
R0924:Spsb3 UTSW 17 24891384 missense probably damaging 0.98
R1291:Spsb3 UTSW 17 24887808 unclassified probably null
R2211:Spsb3 UTSW 17 24890937 critical splice donor site probably null
R2378:Spsb3 UTSW 17 24886950 unclassified probably benign
R4512:Spsb3 UTSW 17 24890296 missense probably damaging 0.97
R4950:Spsb3 UTSW 17 24887511 intron probably benign
R5020:Spsb3 UTSW 17 24887062 unclassified probably benign
R6444:Spsb3 UTSW 17 24891576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTGACAGCAGTCC -3'
(R):5'- ATAGTCGACTCTGTCCTAGCTGC -3'

Sequencing Primer
(F):5'- TTGACCTTGCAGGCGGTC -3'
(R):5'- TGTCCTAGCTGCCTCCTG -3'
Posted On2016-06-21