Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Arhgef4'

396706

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

042738-MU

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34723274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 537 (E537G)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159747]

AlphaFold

Q7TNR9

Predicted Effect

unknown
Transcript: ENSMUST00000159747
AA Change: E537G

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: E537G

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195242
AA Change: E64G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202507
AA Change: E64G

Meta Mutation Damage Score

0.1190

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AATGAGTGCTCTCCAGGAGG -3'
(R):5'- GCCTTCCTTGTAGAAGTCTGC -3'

Sequencing Primer
(F):5'- GAGAGAAAGCCGCCTGATAG -3'
(R):5'- GCTATCATAATGAATTTGCAGCTGTG -3'

Posted On

2016-06-21