Incidental Mutation 'R5156:Olfr1138'
ID396711
Institutional Source Beutler Lab
Gene Symbol Olfr1138
Ensembl Gene ENSMUSG00000075149
Gene Nameolfactory receptor 1138
SynonymsGA_x6K02T2Q125-49242149-49241214, MOR177-8
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87736747-87739978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87737775 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 183 (P183L)
Ref Sequence ENSEMBL: ENSMUSP00000148941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099848] [ENSMUST00000214573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099848
AA Change: P183L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097435
Gene: ENSMUSG00000075149
AA Change: P183L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-45 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214573
AA Change: P183L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.4083 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Olfr1138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Olfr1138 APN 2 87737986 missense probably benign 0.01
IGL02490:Olfr1138 APN 2 87737955 missense probably damaging 1.00
IGL02730:Olfr1138 APN 2 87737641 missense probably damaging 1.00
IGL03106:Olfr1138 APN 2 87738118 missense probably benign 0.02
IGL03113:Olfr1138 APN 2 87738162 missense probably benign 0.01
R0450:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0469:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R0510:Olfr1138 UTSW 2 87737481 missense probably damaging 0.98
R3696:Olfr1138 UTSW 2 87738016 missense probably benign
R3698:Olfr1138 UTSW 2 87738016 missense probably benign
R5149:Olfr1138 UTSW 2 87737405 missense probably benign
R6245:Olfr1138 UTSW 2 87737896 missense possibly damaging 0.54
R6701:Olfr1138 UTSW 2 87737409 missense probably benign
R7170:Olfr1138 UTSW 2 87737712 missense probably damaging 0.99
R7185:Olfr1138 UTSW 2 87738145 missense probably damaging 1.00
R7260:Olfr1138 UTSW 2 87738508 splice site probably null
R8065:Olfr1138 UTSW 2 87737803 missense probably damaging 1.00
R8067:Olfr1138 UTSW 2 87737803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTCAGGTGTGATGTACAG -3'
(R):5'- CTGGCAGTGATGGCATTTGATC -3'

Sequencing Primer
(F):5'- GGTAGAGAAAGCTTTTAACCTCCCAG -3'
(R):5'- GGCATTTGATCGATATAAGGCC -3'
Posted On2016-06-21