Mutagenetix > Incidental Mutation

Incidental Mutation 'R5156:Notch2'

396717

Institutional Source

Beutler Lab

Gene Symbol

Notch2

Ensembl Gene

ENSMUSG00000027878

Gene Name

notch 2

Synonyms

N2, Motch B

MMRRC Submission

042738-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98013527-98150361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98124310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 1167 (F1167V)

Ref Sequence

ENSEMBL: ENSMUSP00000078741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079812]

AlphaFold

O35516

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079812
AA Change: F1167V

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: F1167V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200084

Meta Mutation Damage Score

0.0948

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Notch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Notch2	APN	3	98111675	missense	possibly damaging	0.77
IGL01517:Notch2	APN	3	98138655	missense	probably benign	0.16
IGL01630:Notch2	APN	3	98146618	missense	possibly damaging	0.77
IGL01637:Notch2	APN	3	98146060	missense	probably damaging	1.00
IGL01828:Notch2	APN	3	98072613	missense	probably damaging	1.00
IGL01998:Notch2	APN	3	98143106	missense	probably damaging	1.00
IGL02008:Notch2	APN	3	98147296	missense	probably damaging	1.00
IGL02030:Notch2	APN	3	98099421	splice site	probably null
IGL02155:Notch2	APN	3	98138490	missense	probably damaging	0.98
IGL02268:Notch2	APN	3	98137397	missense	probably damaging	1.00
IGL02301:Notch2	APN	3	98141554	missense	probably benign	0.08
IGL02336:Notch2	APN	3	98138395	missense	possibly damaging	0.73
IGL02340:Notch2	APN	3	98147336	nonsense	probably null
IGL02536:Notch2	APN	3	98102407	missense	probably benign	0.03
IGL02589:Notch2	APN	3	98104347	critical splice acceptor site	probably null
IGL02633:Notch2	APN	3	98116697	splice site	probably benign
IGL02691:Notch2	APN	3	98135607	nonsense	probably null
IGL02832:Notch2	APN	3	98137373	missense	probably benign	0.12
IGL02894:Notch2	APN	3	98102432	nonsense	probably null
IGL02902:Notch2	APN	3	98111574	missense	probably damaging	1.00
IGL02967:Notch2	APN	3	98146144	missense	probably damaging	0.99
IGL03015:Notch2	APN	3	98072649	missense	possibly damaging	0.83
PIT4378001:Notch2	UTSW	3	98142956	missense	probably damaging	1.00
PIT4519001:Notch2	UTSW	3	98098108	missense	probably damaging	1.00
PIT4581001:Notch2	UTSW	3	98104462	missense	probably damaging	1.00
R0111:Notch2	UTSW	3	98138761	missense	probably benign	0.00
R0129:Notch2	UTSW	3	98146620	missense	probably benign	0.08
R0143:Notch2	UTSW	3	98146117	missense	probably damaging	0.99
R0480:Notch2	UTSW	3	98146537	missense	possibly damaging	0.88
R0523:Notch2	UTSW	3	98070970	missense	probably benign	0.34
R0523:Notch2	UTSW	3	98111598	missense	probably benign	0.00
R0531:Notch2	UTSW	3	98102451	splice site	probably benign
R0537:Notch2	UTSW	3	98116741	missense	possibly damaging	0.70
R0987:Notch2	UTSW	3	98134677	splice site	probably null
R1485:Notch2	UTSW	3	98100257	missense	probably benign	0.00
R1555:Notch2	UTSW	3	98131340	missense	possibly damaging	0.93
R1625:Notch2	UTSW	3	98111575	missense	probably damaging	1.00
R1699:Notch2	UTSW	3	98145127	missense	probably damaging	1.00
R1765:Notch2	UTSW	3	98121926	missense	probably damaging	1.00
R1794:Notch2	UTSW	3	98099547	missense	possibly damaging	0.53
R1974:Notch2	UTSW	3	98072755	missense	probably damaging	1.00
R2086:Notch2	UTSW	3	98102367	missense	probably damaging	1.00
R2099:Notch2	UTSW	3	98115321	missense	possibly damaging	0.79
R3778:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R3924:Notch2	UTSW	3	98122034	nonsense	probably null
R4018:Notch2	UTSW	3	98104565	missense	probably damaging	1.00
R4151:Notch2	UTSW	3	98147071	missense	possibly damaging	0.95
R4417:Notch2	UTSW	3	98131270	missense	possibly damaging	0.95
R4510:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4511:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4636:Notch2	UTSW	3	98146104	missense	probably benign	0.02
R4661:Notch2	UTSW	3	98135513	missense	probably damaging	1.00
R4856:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4886:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4945:Notch2	UTSW	3	98111721	missense	probably benign	0.01
R4970:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R4974:Notch2	UTSW	3	98139633	missense	probably benign	0.39
R5082:Notch2	UTSW	3	98100374	missense	probably damaging	1.00
R5112:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R5433:Notch2	UTSW	3	98126134	missense	probably damaging	1.00
R5539:Notch2	UTSW	3	98137582	missense	probably damaging	0.99
R5813:Notch2	UTSW	3	98135428	missense	probably benign
R5827:Notch2	UTSW	3	98072862	missense	possibly damaging	0.64
R5908:Notch2	UTSW	3	98123923	intron	probably benign
R6021:Notch2	UTSW	3	98121972	missense	probably damaging	1.00
R6090:Notch2	UTSW	3	98135377	nonsense	probably null
R6103:Notch2	UTSW	3	98135743	missense	possibly damaging	0.94
R6111:Notch2	UTSW	3	98146293	missense	probably benign	0.00
R6168:Notch2	UTSW	3	98145217	missense	probably damaging	1.00
R6382:Notch2	UTSW	3	98141543	missense	probably damaging	1.00
R6404:Notch2	UTSW	3	98081998	missense	probably damaging	1.00
R6419:Notch2	UTSW	3	98100389	critical splice donor site	probably null
R6454:Notch2	UTSW	3	98137406	missense	possibly damaging	0.47
R6626:Notch2	UTSW	3	98101605	missense	probably damaging	1.00
R6629:Notch2	UTSW	3	98120881	missense	possibly damaging	0.65
R6706:Notch2	UTSW	3	98138430	missense	possibly damaging	0.94
R6735:Notch2	UTSW	3	98134586	missense	probably damaging	1.00
R6837:Notch2	UTSW	3	98070854	splice site	probably null
R7021:Notch2	UTSW	3	98135446	missense	probably benign
R7028:Notch2	UTSW	3	98102387	missense	probably damaging	1.00
R7228:Notch2	UTSW	3	98137317	nonsense	probably null
R7320:Notch2	UTSW	3	98131327	missense	possibly damaging	0.94
R7361:Notch2	UTSW	3	98131402	missense	probably benign	0.04
R7562:Notch2	UTSW	3	98113114	missense	probably damaging	1.00
R7630:Notch2	UTSW	3	98137508	missense	possibly damaging	0.65
R7637:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R7748:Notch2	UTSW	3	98138484	missense	possibly damaging	0.69
R7764:Notch2	UTSW	3	98142988	missense	probably damaging	1.00
R7817:Notch2	UTSW	3	98107127	missense	probably damaging	1.00
R7952:Notch2	UTSW	3	98100236	missense	probably benign	0.30
R8136:Notch2	UTSW	3	98124221	missense	probably damaging	1.00
R8159:Notch2	UTSW	3	98120922	missense	possibly damaging	0.95
R8679:Notch2	UTSW	3	98121902	critical splice acceptor site	probably null
R8879:Notch2	UTSW	3	98135599	missense	possibly damaging	0.73
R9146:Notch2	UTSW	3	98104538	missense	probably damaging	1.00
R9398:Notch2	UTSW	3	98102352	missense	probably damaging	1.00
R9422:Notch2	UTSW	3	98147352	missense	probably damaging	1.00
R9594:Notch2	UTSW	3	98134573	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CAGGCTCACTTGCTTTTGG -3'
(R):5'- GCTATGGGAAAGCATGGCTG -3'

Sequencing Primer
(F):5'- CACTTGCTTTTGGGTTGAACC -3'
(R):5'- CTGAAAATAAAAATGCTGGCTGC -3'

Posted On

2016-06-21