Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Csf1'

396718

Institutional Source

Beutler Lab

Gene Symbol

Csf1

Ensembl Gene

ENSMUSG00000014599

Gene Name

colony stimulating factor 1 (macrophage)

Synonyms

colony-stimulating factor-1, CSF-1, Csfm, M-CSF

MMRRC Submission

042738-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.659) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107741048-107760469 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107748936 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 148 (T148S)

Ref Sequence

ENSEMBL: ENSMUSP00000119553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]

Predicted Effect

probably benign
Transcript: ENSMUST00000014743
AA Change: T260S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: T260S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118593

SMART Domains

Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	257	9.5e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120243
AA Change: T260S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: T260S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	1	254	6.8e-91	PFAM
Pfam:CSF-1	272	552	1.1e-147	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120654

SMART Domains

Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	31	163	1.7e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153114

SMART Domains

Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599

Domain	Start	End	E-Value	Type
Pfam:CSF-1	26	182	1.1e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155557

Predicted Effect

probably benign
Transcript: ENSMUST00000156820
AA Change: T148S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599
AA Change: T148S

Domain	Start	End	E-Value	Type
Pfam:CSF-1	15	142	6e-37	PFAM
Pfam:CSF-1	160	279	4.9e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Csf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Csf1	APN	3	107756727	missense	probably benign	0.00
IGL00907:Csf1	APN	3	107750346	missense	probably damaging	1.00
IGL01644:Csf1	APN	3	107753842	missense	possibly damaging	0.84
R0022:Csf1	UTSW	3	107753862	missense	probably damaging	0.99
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0025:Csf1	UTSW	3	107748644	missense	probably benign
R0350:Csf1	UTSW	3	107748606	missense	probably benign	0.01
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1392:Csf1	UTSW	3	107756630	missense	probably benign	0.03
R1531:Csf1	UTSW	3	107748338	missense	possibly damaging	0.72
R1897:Csf1	UTSW	3	107748279	missense	probably damaging	1.00
R4373:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4375:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4376:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4377:Csf1	UTSW	3	107756739	missense	probably damaging	1.00
R4469:Csf1	UTSW	3	107750681	critical splice donor site	probably null
R4474:Csf1	UTSW	3	107753856	missense	probably damaging	0.98
R4604:Csf1	UTSW	3	107756962	splice site	probably null
R4634:Csf1	UTSW	3	107749167	missense	probably damaging	0.96
R5086:Csf1	UTSW	3	107748710	missense	possibly damaging	0.72
R5425:Csf1	UTSW	3	107748896	missense	possibly damaging	0.96
R6120:Csf1	UTSW	3	107753854	missense	probably damaging	0.96
R6268:Csf1	UTSW	3	107747157	missense	possibly damaging	0.86
R6269:Csf1	UTSW	3	107749001	missense	probably benign	0.04
R6273:Csf1	UTSW	3	107749163	missense	probably damaging	1.00
R6298:Csf1	UTSW	3	107748359	missense	possibly damaging	0.96
R7196:Csf1	UTSW	3	107753898	missense	possibly damaging	0.91
R7375:Csf1	UTSW	3	107748179	missense	possibly damaging	0.96
R7437:Csf1	UTSW	3	107750756	missense	probably benign	0.00
R7464:Csf1	UTSW	3	107748875	missense	probably benign	0.03
R7780:Csf1	UTSW	3	107750393	missense	probably damaging	0.96
R7808:Csf1	UTSW	3	107760045	missense	possibly damaging	0.70
R8153:Csf1	UTSW	3	107748704	missense	probably damaging	0.98
Z1177:Csf1	UTSW	3	107749080	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GGGGAAAACTTTGCTTCCTGG -3'
(R):5'- TGCCTGTACCCTAAAGCCAC -3'

Sequencing Primer
(F):5'- GCTTCCTGGGTCAAAAATCCC -3'
(R):5'- AGCCACCCCTAGCAGTG -3'

Posted On

2016-06-21