Mutagenetix > Incidental Mutation

Incidental Mutation 'R5156:Vmn2r10'

396723

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r10

Ensembl Gene

ENSMUSG00000067010

Gene Name

vomeronasal 2, receptor 10

Synonyms

V2r16, VR16

MMRRC Submission

042738-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108993412-109006471 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108995600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 828 (V828A)

Ref Sequence

ENSEMBL: ENSMUSP00000078162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]

AlphaFold

K7N621

Predicted Effect

probably benign
Transcript: ENSMUST00000079163
AA Change: V828A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: V828A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	8.5e-29	PFAM
Pfam:NCD3G	506	560	3.8e-17	PFAM
Pfam:7tm_3	593	828	4e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176594

SMART Domains

Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Vmn2r10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Vmn2r10	APN	5	109002585	missense	possibly damaging	0.75
IGL01618:Vmn2r10	APN	5	109002479	missense	probably damaging	1.00
IGL01624:Vmn2r10	APN	5	109006246	missense	possibly damaging	0.83
IGL01941:Vmn2r10	APN	5	108995954	missense	probably damaging	1.00
IGL01959:Vmn2r10	APN	5	108997705	missense	probably benign	0.00
IGL01973:Vmn2r10	APN	5	108995677	missense	probably damaging	1.00
IGL01985:Vmn2r10	APN	5	109006259	missense	probably benign	0.21
IGL02451:Vmn2r10	APN	5	108995922	nonsense	probably null
IGL02503:Vmn2r10	APN	5	109003475	missense	probably damaging	1.00
IGL03275:Vmn2r10	APN	5	109003377	missense	probably benign	0.00
R0035:Vmn2r10	UTSW	5	108997601	splice site	probably benign
R0395:Vmn2r10	UTSW	5	109001993	missense	probably damaging	1.00
R0454:Vmn2r10	UTSW	5	109003461	missense	probably benign	0.25
R0648:Vmn2r10	UTSW	5	108995916	missense	probably benign	0.00
R1251:Vmn2r10	UTSW	5	108996024	missense	probably benign	0.01
R1580:Vmn2r10	UTSW	5	109006251	missense	possibly damaging	0.82
R1845:Vmn2r10	UTSW	5	109001995	nonsense	probably null
R1986:Vmn2r10	UTSW	5	109006254	nonsense	probably null
R2137:Vmn2r10	UTSW	5	109003544	missense	possibly damaging	0.87
R2495:Vmn2r10	UTSW	5	108996095	missense	probably damaging	1.00
R3932:Vmn2r10	UTSW	5	109002222	missense	possibly damaging	0.47
R3933:Vmn2r10	UTSW	5	109002222	missense	possibly damaging	0.47
R4899:Vmn2r10	UTSW	5	109003458	missense	probably damaging	1.00
R4992:Vmn2r10	UTSW	5	108997726	missense	possibly damaging	0.89
R5124:Vmn2r10	UTSW	5	109006420	missense	probably benign	0.01
R5145:Vmn2r10	UTSW	5	108995895	missense	possibly damaging	0.64
R5265:Vmn2r10	UTSW	5	108995720	missense	probably damaging	1.00
R5311:Vmn2r10	UTSW	5	109006255	missense	probably damaging	1.00
R5321:Vmn2r10	UTSW	5	108995639	missense	probably damaging	1.00
R5666:Vmn2r10	UTSW	5	108999044	nonsense	probably null
R5670:Vmn2r10	UTSW	5	108999044	nonsense	probably null
R5872:Vmn2r10	UTSW	5	109003511	missense	possibly damaging	0.84
R6004:Vmn2r10	UTSW	5	108999078	missense	probably benign	0.30
R6108:Vmn2r10	UTSW	5	108995801	missense	probably damaging	1.00
R6332:Vmn2r10	UTSW	5	109003462	missense	probably damaging	1.00
R6599:Vmn2r10	UTSW	5	108996078	missense	probably benign	0.09
R6651:Vmn2r10	UTSW	5	108995622	missense	probably null	0.22
R6891:Vmn2r10	UTSW	5	109001979	missense	probably damaging	1.00
R7023:Vmn2r10	UTSW	5	109002028	missense	probably damaging	0.96
R7146:Vmn2r10	UTSW	5	109003334	missense	probably damaging	1.00
R7941:Vmn2r10	UTSW	5	108996440	missense	probably damaging	1.00
R8058:Vmn2r10	UTSW	5	109002089	missense	probably benign	0.00
R8478:Vmn2r10	UTSW	5	108995770	missense	probably damaging	1.00
R8526:Vmn2r10	UTSW	5	108997706	missense	possibly damaging	0.51
R8698:Vmn2r10	UTSW	5	109003524	missense	probably benign	0.00
R8796:Vmn2r10	UTSW	5	108996051	missense	possibly damaging	0.74
R8854:Vmn2r10	UTSW	5	108996260	missense	probably benign	0.20
R8871:Vmn2r10	UTSW	5	108999033	missense	possibly damaging	0.67
R8893:Vmn2r10	UTSW	5	108995811	missense	probably benign	0.09
R8907:Vmn2r10	UTSW	5	109001925	missense	probably benign
R8957:Vmn2r10	UTSW	5	109001914	missense	possibly damaging	0.60
R8976:Vmn2r10	UTSW	5	108997613	missense	probably damaging	1.00
R9155:Vmn2r10	UTSW	5	108996346	missense	probably benign	0.10
R9308:Vmn2r10	UTSW	5	108997610	nonsense	probably null
R9800:Vmn2r10	UTSW	5	109002538	missense	probably damaging	0.99
Z1088:Vmn2r10	UTSW	5	108996113	missense	probably damaging	1.00
Z1176:Vmn2r10	UTSW	5	109001988	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATTACATTAGGCAGTGC -3'
(R):5'- CTTCCTGACAGATTCAATGAAGCC -3'

Sequencing Primer
(F):5'- CATTACATTAGGCAGTGCTGTGC -3'
(R):5'- CAAATTCTTAACCTTCAGCATGCTGG -3'

Posted On

2016-06-21