Incidental Mutation 'R5156:Foxk1'
ID396725
Institutional Source Beutler Lab
Gene Symbol Foxk1
Ensembl Gene ENSMUSG00000056493
Gene Nameforkhead box K1
SynonymsMnf, A630048H08Rik
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5156 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location142401497-142462011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142448833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 284 (D284G)
Ref Sequence ENSEMBL: ENSMUSP00000072616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072837]
PDB Structure
Solution structure and Dynamics of DNA-Binding Domain of Myocyte Nuclear Factor [SOLUTION NMR]
Solution structure and Dynamics of the DNA-Binding Domain of Myocyte Nuclear Factor [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072837
AA Change: D284G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072616
Gene: ENSMUSG00000056493
AA Change: D284G

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 19 84 N/A INTRINSIC
FHA 108 161 1.14e-9 SMART
low complexity region 261 281 N/A INTRINSIC
FH 289 380 1.31e-50 SMART
Blast:FH 402 458 8e-28 BLAST
low complexity region 627 642 N/A INTRINSIC
low complexity region 652 687 N/A INTRINSIC
low complexity region 696 713 N/A INTRINSIC
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and exhibit a reduced myogenic progenitor cell population with impaired cell cycle progression (G0/G1 arrest) and decreased proliferative capacity that results in severe impairment of skeletal muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Foxk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Foxk1 APN 5 142453589 missense probably damaging 0.99
IGL02122:Foxk1 APN 5 142451429 splice site probably benign
IGL02686:Foxk1 APN 5 142453585 missense probably damaging 0.99
R0027:Foxk1 UTSW 5 142450340 missense probably damaging 1.00
R0217:Foxk1 UTSW 5 142401894 missense possibly damaging 0.93
R0256:Foxk1 UTSW 5 142453681 splice site probably benign
R0481:Foxk1 UTSW 5 142448823 missense probably benign 0.09
R1941:Foxk1 UTSW 5 142456674 missense possibly damaging 0.67
R2128:Foxk1 UTSW 5 142435188 nonsense probably null
R2129:Foxk1 UTSW 5 142435188 nonsense probably null
R2356:Foxk1 UTSW 5 142455409 missense possibly damaging 0.93
R5958:Foxk1 UTSW 5 142456674 missense probably benign 0.06
R7686:Foxk1 UTSW 5 142401870 missense probably damaging 0.99
R8141:Foxk1 UTSW 5 142453961 missense probably damaging 1.00
R8406:Foxk1 UTSW 5 142401773 missense unknown
R8433:Foxk1 UTSW 5 142448784 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGTCTCAGACTGACTGTG -3'
(R):5'- AATGTCTCACTAGCGGTGGAC -3'

Sequencing Primer
(F):5'- GGTCATCCAGTTATCGCT -3'
(R):5'- TCTCACTAGCGGTGGACAGAAC -3'
Posted On2016-06-21