Incidental Mutation 'R5156:Sec13'
ID396726
Institutional Source Beutler Lab
Gene Symbol Sec13
Ensembl Gene ENSMUSG00000030298
Gene NameSEC13 homolog, nuclear pore and COPII coat complex component
Synonyms1110003H02Rik, Sec13r, Sec13l1
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113728062-113740743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113730876 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 161 (A161V)
Ref Sequence ENSEMBL: ENSMUSP00000032440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032440]
Predicted Effect probably benign
Transcript: ENSMUST00000032440
AA Change: A161V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032440
Gene: ENSMUSG00000030298
AA Change: A161V

DomainStartEndE-ValueType
WD40 1 41 7.39e-3 SMART
WD40 46 87 5.55e-7 SMART
WD40 92 133 8.75e-5 SMART
WD40 139 195 2.67e-1 SMART
WD40 201 244 6.73e-6 SMART
WD40 254 290 9.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203364
Meta Mutation Damage Score 0.1833 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Sec13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Sec13 APN 6 113736420 missense probably damaging 1.00
R0470:Sec13 UTSW 6 113740632 unclassified probably benign
R0507:Sec13 UTSW 6 113735119 missense probably damaging 1.00
R1269:Sec13 UTSW 6 113737995 missense probably damaging 0.98
R4120:Sec13 UTSW 6 113734676 missense probably damaging 1.00
R4624:Sec13 UTSW 6 113729691 missense probably benign 0.02
R4938:Sec13 UTSW 6 113735192 missense probably damaging 1.00
R6065:Sec13 UTSW 6 113730832 missense probably benign 0.01
R6302:Sec13 UTSW 6 113735206 missense probably damaging 1.00
R7265:Sec13 UTSW 6 113735136 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGACTTTACTGGCAGGGAG -3'
(R):5'- ACCCCTACTTGGTGTGTATGTAC -3'

Sequencing Primer
(F):5'- GAAAGGTGATCTTGCTTTTTGTACAC -3'
(R):5'- TGGCAGGTCAACAATCTTGC -3'
Posted On2016-06-21