Incidental Mutation 'R5156:Ppp1r37'
ID396729
Institutional Source Beutler Lab
Gene Symbol Ppp1r37
Ensembl Gene ENSMUSG00000051403
Gene Nameprotein phosphatase 1, regulatory subunit 37
SynonymsLrrc68
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5156 (G1)
Quality Score90
Status Not validated
Chromosome7
Chromosomal Location19530800-19563076 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 19561975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051364] [ENSMUST00000058444] [ENSMUST00000117222] [ENSMUST00000119912] [ENSMUST00000122055] [ENSMUST00000122127] [ENSMUST00000151646] [ENSMUST00000208826]
Predicted Effect probably benign
Transcript: ENSMUST00000051364
SMART Domains Protein: ENSMUSP00000055844
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000058444
AA Change: D19G
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403
AA Change: D19G

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117222
SMART Domains Protein: ENSMUSP00000113266
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119912
SMART Domains Protein: ENSMUSP00000112742
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122055
SMART Domains Protein: ENSMUSP00000113583
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122127
SMART Domains Protein: ENSMUSP00000113709
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151646
SMART Domains Protein: ENSMUSP00000116207
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 81 7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208826
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Ppp1r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0313:Ppp1r37 UTSW 7 19533998 missense probably damaging 1.00
R0718:Ppp1r37 UTSW 7 19532254 missense probably benign
R0883:Ppp1r37 UTSW 7 19532177 missense probably benign 0.01
R1606:Ppp1r37 UTSW 7 19534999 missense probably damaging 0.97
R2220:Ppp1r37 UTSW 7 19532446 missense probably null 0.43
R2256:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2257:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2325:Ppp1r37 UTSW 7 19532684 missense probably damaging 1.00
R2510:Ppp1r37 UTSW 7 19532432 missense possibly damaging 0.79
R3401:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R3402:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R4006:Ppp1r37 UTSW 7 19535069 missense probably damaging 1.00
R4750:Ppp1r37 UTSW 7 19531520 missense probably benign
R4956:Ppp1r37 UTSW 7 19532711 nonsense probably null
R5582:Ppp1r37 UTSW 7 19532294 missense probably damaging 1.00
R5659:Ppp1r37 UTSW 7 19535523 missense probably damaging 1.00
R5918:Ppp1r37 UTSW 7 19532111 missense probably benign 0.02
R6172:Ppp1r37 UTSW 7 19532404 missense possibly damaging 0.93
R6659:Ppp1r37 UTSW 7 19532123 missense probably benign 0.00
R7626:Ppp1r37 UTSW 7 19561853 missense probably damaging 0.99
R7779:Ppp1r37 UTSW 7 19532787 missense possibly damaging 0.81
R7785:Ppp1r37 UTSW 7 19532071 missense probably damaging 1.00
R7819:Ppp1r37 UTSW 7 19534064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCTACCGTGTCTCCAG -3'
(R):5'- AAGCTTGAGTCGGTGCTATGC -3'

Sequencing Primer
(F):5'- AGGGGTCTTTGGGCTCCAC -3'
(R):5'- CCTTCGGCTTGTAGCGAAAG -3'
Posted On2016-06-21