Incidental Mutation 'R5156:Vmn2r75'
ID396731
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Namevomeronasal 2, receptor 75
SynonymsEG546981
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86148042-86171724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86164228 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 455 (L455F)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167830
AA Change: L455F

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: L455F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 86148032 unclassified probably benign
IGL01287:Vmn2r75 APN 7 86148593 missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 86165566 missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 86171662 nonsense probably null
IGL01406:Vmn2r75 APN 7 86163292 splice site probably benign
IGL01615:Vmn2r75 APN 7 86148473 missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 86164247 missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 86165578 missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 86165140 missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 86165766 missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 86148703 missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 86148436 missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 86171725 unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 86165583 missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0083:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 86148307 missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 86165080 missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 86165513 missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 86148241 nonsense probably null
R0631:Vmn2r75 UTSW 7 86163270 missense probably null 1.00
R0661:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 86164268 missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 86148590 missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 86165642 missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 86148811 missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 86148262 missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 86165164 missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 86148936 missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 86148421 missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 86164286 missense probably null 1.00
R4532:Vmn2r75 UTSW 7 86148141 nonsense probably null
R4583:Vmn2r75 UTSW 7 86164082 missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 86166286 missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 86163170 missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 86148403 missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 86171579 missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 86165497 missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 86166167 critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 86165527 missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 86164164 missense probably benign
R5243:Vmn2r75 UTSW 7 86164239 missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 86166292 missense probably benign
R5574:Vmn2r75 UTSW 7 86166302 missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 86148494 missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 86171571 missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 86165370 missense probably benign
R6021:Vmn2r75 UTSW 7 86171612 missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 86166167 critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 86165274 missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 86171576 missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 86164079 missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 86164245 missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 86148436 missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 86166360 missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R8411:Vmn2r75 UTSW 7 86148514 missense probably damaging 1.00
R8507:Vmn2r75 UTSW 7 86148477 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGAATCATGCTACATCTTAAGG -3'
(R):5'- TGTCTTTAGCACTGAATACTTCTGG -3'

Sequencing Primer
(F):5'- ATCTGTAGCCCACTCCAT -3'
(R):5'- TGTGTAAGCCTAATTGAAACT -3'
Posted On2016-06-21