Mutagenetix > Incidental Mutation

Incidental Mutation 'R5156:Dmbt1'

396732

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin

MMRRC Submission

042738-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130633787-130723357 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 130699400 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000084509

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084509

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208311

Predicted Effect

probably null
Transcript: ENSMUST00000208311

Predicted Effect

probably null
Transcript: ENSMUST00000213064

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	G	T	17: 79,935,638 (GRCm39)		probably benign	Het
Apeh	C	T	9: 107,971,486 (GRCm39)	A29T	probably damaging	Het
Arap2	A	T	5: 62,826,524 (GRCm39)	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,762,355 (GRCm39)	E537G	unknown	Het
Asf1b	T	C	8: 84,682,540 (GRCm39)	F28S	probably damaging	Het
Cd46	T	A	1: 194,767,693 (GRCm39)	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,309,370 (GRCm39)	T48S	probably damaging	Het
Cfap53	T	A	18: 74,492,838 (GRCm39)		probably benign	Het
Clca3a2	T	A	3: 144,511,599 (GRCm39)	T599S	probably benign	Het
Csf1	T	A	3: 107,656,252 (GRCm39)	T148S	probably benign	Het
Dmpk	A	G	7: 18,818,050 (GRCm39)	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,728,782 (GRCm39)	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,595,264 (GRCm39)	M1392K	probably benign	Het
Edrf1	C	T	7: 133,261,908 (GRCm39)	A867V	probably damaging	Het
Efemp2	T	A	19: 5,527,706 (GRCm39)	C94S	possibly damaging	Het
Epha8	C	T	4: 136,666,037 (GRCm39)	S373N	probably benign	Het
Foxk1	A	G	5: 142,434,588 (GRCm39)	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,678,366 (GRCm39)	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,358,665 (GRCm39)		noncoding transcript	Het
Gm6818	A	T	7: 38,101,471 (GRCm39)		noncoding transcript	Het
Hydin	T	A	8: 111,336,333 (GRCm39)	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,719,448 (GRCm39)	M492K	probably damaging	Het
Krt20	G	T	11: 99,320,879 (GRCm39)	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,653,094 (GRCm39)	R107S	probably benign	Het
Mia2	A	G	12: 59,219,323 (GRCm39)	T436A	possibly damaging	Het
Muc19	T	A	15: 91,784,614 (GRCm39)		noncoding transcript	Het
Neu4	T	C	1: 93,952,177 (GRCm39)	V182A	probably damaging	Het
Notch2	T	G	3: 98,031,626 (GRCm39)	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,360,277 (GRCm39)	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,765,487 (GRCm39)	I172F	probably damaging	Het
Or5b118	G	T	19: 13,449,037 (GRCm39)	K234N	probably damaging	Het
Or5w15	G	A	2: 87,568,119 (GRCm39)	P183L	possibly damaging	Het
Or8k41	A	T	2: 86,313,362 (GRCm39)	C241*	probably null	Het
Plekha5	C	T	6: 140,372,254 (GRCm39)	T68M	probably damaging	Het
Ppef2	A	G	5: 92,392,461 (GRCm39)		probably null	Het
Ppp1r37	T	C	7: 19,295,900 (GRCm39)		probably benign	Het
Rfx4	T	C	10: 84,704,218 (GRCm39)	Y238H	probably damaging	Het
Sanbr	A	G	11: 23,543,424 (GRCm39)		probably null	Het
Sec13	G	A	6: 113,707,837 (GRCm39)	A161V	probably benign	Het
Serhl	G	A	15: 82,986,895 (GRCm39)		probably benign	Het
Slco4a1	T	C	2: 180,114,572 (GRCm39)	V588A	probably benign	Het
Slitrk3	T	C	3: 72,956,592 (GRCm39)	T727A	probably benign	Het
Sp100	T	A	1: 85,601,404 (GRCm39)	D241E	probably damaging	Het
Spata2	G	T	2: 167,325,494 (GRCm39)	H442N	probably damaging	Het
Speg	T	C	1: 75,404,731 (GRCm39)	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,578,155 (GRCm39)	S141P	probably damaging	Het
Trank1	A	G	9: 111,219,762 (GRCm39)	I2166M	probably damaging	Het
Trim10	T	A	17: 37,187,948 (GRCm39)	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,636 (GRCm39)	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 109,143,466 (GRCm39)	V828A	probably benign	Het
Vmn2r75	T	A	7: 85,813,436 (GRCm39)	L455F	possibly damaging	Het
Vwa8	T	A	14: 79,221,666 (GRCm39)	S541T	probably benign	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	130,681,270 (GRCm39)	intron	probably benign
IGL00161:Dmbt1	APN	7	130,711,357 (GRCm39)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	130,701,020 (GRCm39)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	130,684,230 (GRCm39)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	130,699,337 (GRCm39)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	130,659,888 (GRCm39)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	130,687,098 (GRCm39)	splice site	probably benign
IGL01317:Dmbt1	APN	7	130,642,921 (GRCm39)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	130,690,497 (GRCm39)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	130,705,409 (GRCm39)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	130,718,457 (GRCm39)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	130,682,915 (GRCm39)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	130,676,149 (GRCm39)	intron	probably benign
IGL02160:Dmbt1	APN	7	130,684,418 (GRCm39)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	130,694,986 (GRCm39)	splice site	probably benign
IGL02197:Dmbt1	APN	7	130,687,152 (GRCm39)	splice site	probably benign
IGL02332:Dmbt1	APN	7	130,668,343 (GRCm39)	intron	probably benign
IGL02427:Dmbt1	APN	7	130,689,815 (GRCm39)	splice site	probably null
IGL02726:Dmbt1	APN	7	130,676,140 (GRCm39)	intron	probably benign
IGL02967:Dmbt1	APN	7	130,672,919 (GRCm39)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	130,684,409 (GRCm39)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	130,712,778 (GRCm39)	missense	probably damaging	0.99
cavity	UTSW	7	130,713,965 (GRCm39)	missense	unknown
lacunar	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	130,713,805 (GRCm39)	nonsense	probably null
K3955:Dmbt1	UTSW	7	130,721,293 (GRCm39)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	130,708,123 (GRCm39)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	130,697,779 (GRCm39)	splice site	probably benign
R0427:Dmbt1	UTSW	7	130,642,632 (GRCm39)	nonsense	probably null
R0478:Dmbt1	UTSW	7	130,642,917 (GRCm39)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	130,699,403 (GRCm39)	splice site	probably null
R0538:Dmbt1	UTSW	7	130,651,631 (GRCm39)	splice site	probably benign
R0626:Dmbt1	UTSW	7	130,703,811 (GRCm39)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	130,699,383 (GRCm39)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	130,694,847 (GRCm39)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	130,676,254 (GRCm39)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	130,651,944 (GRCm39)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	130,646,217 (GRCm39)	splice site	probably benign
R1463:Dmbt1	UTSW	7	130,711,366 (GRCm39)	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	130,676,061 (GRCm39)	intron	probably benign
R1990:Dmbt1	UTSW	7	130,660,018 (GRCm39)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	130,708,089 (GRCm39)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	130,700,863 (GRCm39)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	130,651,748 (GRCm39)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	130,703,762 (GRCm39)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	130,699,305 (GRCm39)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	130,648,292 (GRCm39)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	130,692,224 (GRCm39)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	130,708,198 (GRCm39)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	130,696,464 (GRCm39)	nonsense	probably null
R3014:Dmbt1	UTSW	7	130,633,827 (GRCm39)	intron	probably benign
R3155:Dmbt1	UTSW	7	130,651,887 (GRCm39)	nonsense	probably null
R3176:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	130,707,979 (GRCm39)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	130,713,819 (GRCm39)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	130,675,932 (GRCm39)	intron	probably benign
R4396:Dmbt1	UTSW	7	130,718,361 (GRCm39)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	130,642,664 (GRCm39)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	130,651,742 (GRCm39)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	130,696,472 (GRCm39)	missense	probably benign	0.01
R5225:Dmbt1	UTSW	7	130,696,465 (GRCm39)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	130,684,349 (GRCm39)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	130,642,751 (GRCm39)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	130,721,240 (GRCm39)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	130,642,723 (GRCm39)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	130,665,133 (GRCm39)	intron	probably benign
R5526:Dmbt1	UTSW	7	130,642,920 (GRCm39)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	130,701,030 (GRCm39)	nonsense	probably null
R5566:Dmbt1	UTSW	7	130,708,003 (GRCm39)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	130,655,797 (GRCm39)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	130,711,370 (GRCm39)	splice site	probably null
R6188:Dmbt1	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	130,705,308 (GRCm39)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	130,718,370 (GRCm39)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	130,648,240 (GRCm39)	splice site	probably null
R6719:Dmbt1	UTSW	7	130,721,332 (GRCm39)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	130,648,291 (GRCm39)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	130,668,464 (GRCm39)	nonsense	probably null
R7191:Dmbt1	UTSW	7	130,646,250 (GRCm39)	missense	unknown
R7269:Dmbt1	UTSW	7	130,668,351 (GRCm39)	missense	unknown
R7288:Dmbt1	UTSW	7	130,685,519 (GRCm39)	nonsense	probably null
R7296:Dmbt1	UTSW	7	130,713,861 (GRCm39)	missense	unknown
R7349:Dmbt1	UTSW	7	130,642,854 (GRCm39)	missense	unknown
R7386:Dmbt1	UTSW	7	130,713,965 (GRCm39)	missense	unknown
R7428:Dmbt1	UTSW	7	130,710,192 (GRCm39)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	130,681,241 (GRCm39)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	130,668,192 (GRCm39)	missense	unknown
R7513:Dmbt1	UTSW	7	130,692,242 (GRCm39)	missense	unknown
R7553:Dmbt1	UTSW	7	130,706,597 (GRCm39)	missense	unknown
R7567:Dmbt1	UTSW	7	130,663,093 (GRCm39)	splice site	probably null
R7584:Dmbt1	UTSW	7	130,690,481 (GRCm39)	nonsense	probably null
R7736:Dmbt1	UTSW	7	130,718,625 (GRCm39)	missense	unknown
R7758:Dmbt1	UTSW	7	130,722,926 (GRCm39)	missense	unknown
R7928:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	130,690,500 (GRCm39)	missense	unknown
R8098:Dmbt1	UTSW	7	130,710,188 (GRCm39)	nonsense	probably null
R8125:Dmbt1	UTSW	7	130,700,953 (GRCm39)	missense	unknown
R8177:Dmbt1	UTSW	7	130,708,162 (GRCm39)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	130,668,330 (GRCm39)	missense	unknown
R8378:Dmbt1	UTSW	7	130,708,195 (GRCm39)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8400:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8445:Dmbt1	UTSW	7	130,692,110 (GRCm39)	missense	unknown
R8450:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	130,703,742 (GRCm39)	missense	unknown
R8688:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	unknown
R8850:Dmbt1	UTSW	7	130,692,134 (GRCm39)	missense	unknown
R8852:Dmbt1	UTSW	7	130,642,853 (GRCm39)	missense	unknown
R8871:Dmbt1	UTSW	7	130,718,597 (GRCm39)	missense	unknown
R8943:Dmbt1	UTSW	7	130,721,372 (GRCm39)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	130,639,611 (GRCm39)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	130,713,798 (GRCm39)	missense	unknown
R9020:Dmbt1	UTSW	7	130,712,787 (GRCm39)	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	130,718,418 (GRCm39)	missense	unknown
R9230:Dmbt1	UTSW	7	130,639,642 (GRCm39)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	130,700,855 (GRCm39)	missense	unknown
R9377:Dmbt1	UTSW	7	130,694,832 (GRCm39)	missense	unknown
R9428:Dmbt1	UTSW	7	130,668,208 (GRCm39)	missense	unknown
R9474:Dmbt1	UTSW	7	130,675,987 (GRCm39)	missense	unknown
R9573:Dmbt1	UTSW	7	130,657,910 (GRCm39)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	130,712,652 (GRCm39)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	130,660,015 (GRCm39)	missense	unknown
R9781:Dmbt1	UTSW	7	130,639,599 (GRCm39)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	130,713,977 (GRCm39)	nonsense	probably null
X0062:Dmbt1	UTSW	7	130,696,581 (GRCm39)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	130,690,542 (GRCm39)	missense	unknown
Z1177:Dmbt1	UTSW	7	130,684,215 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGTGCATTATGATCCAGC -3'
(R):5'- GTGCAAATTCATGACAATCTGGG -3'

Sequencing Primer
(F):5'- CCAGCATTATGTAGTTCATCAGC -3'
(R):5'- TCATGACAATCTGGGGCTATAAGAC -3'

Posted On

2016-06-21