Incidental Mutation 'R5156:Apeh'
ID396736
Institutional Source Beutler Lab
Gene Symbol Apeh
Ensembl Gene ENSMUSG00000032590
Gene Nameacylpeptide hydrolase
SynonymsN-acylaminoacyl peptide hydrolase
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108085413-108094606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108094287 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 29 (A29T)
Ref Sequence ENSEMBL: ENSMUSP00000141856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208] [ENSMUST00000191985] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035208
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081309
AA Change: A27T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590
AA Change: A27T

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Predicted Effect probably damaging
Transcript: ENSMUST00000191985
AA Change: A54T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142150
Gene: ENSMUSG00000032590
AA Change: A54T

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192278
Predicted Effect probably damaging
Transcript: ENSMUST00000193254
AA Change: A29T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590
AA Change: A29T

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Meta Mutation Damage Score 0.3566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Apeh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Apeh APN 9 108086207 missense probably benign
IGL02232:Apeh APN 9 108091872 missense probably benign 0.02
IGL02563:Apeh APN 9 108093709 missense possibly damaging 0.85
IGL02713:Apeh APN 9 108085672 missense probably damaging 1.00
IGL02794:Apeh APN 9 108092010 missense possibly damaging 0.94
IGL03355:Apeh APN 9 108086445 missense probably benign 0.00
R6807_Apeh_606 UTSW 9 108092679 missense probably damaging 1.00
R0511:Apeh UTSW 9 108087055 missense probably benign
R1221:Apeh UTSW 9 108092609 missense probably benign
R1574:Apeh UTSW 9 108092726 splice site probably null
R1863:Apeh UTSW 9 108092103 missense possibly damaging 0.91
R2126:Apeh UTSW 9 108085667 missense probably damaging 1.00
R2353:Apeh UTSW 9 108086292 missense possibly damaging 0.84
R4930:Apeh UTSW 9 108087825 missense probably benign
R5278:Apeh UTSW 9 108091258 missense probably benign 0.08
R5366:Apeh UTSW 9 108091806 missense probably benign 0.01
R5384:Apeh UTSW 9 108086463 missense probably damaging 1.00
R5940:Apeh UTSW 9 108091899 splice site probably null
R6102:Apeh UTSW 9 108086439 missense probably damaging 1.00
R6300:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6368:Apeh UTSW 9 108087243 missense probably damaging 1.00
R6807:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6809:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6817:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6828:Apeh UTSW 9 108087038 missense probably damaging 1.00
R6866:Apeh UTSW 9 108092679 missense probably damaging 1.00
R7034:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7036:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7139:Apeh UTSW 9 108092146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACCTTCAACTCATTTACGG -3'
(R):5'- CGAAAGACCGACTATGGAGC -3'

Sequencing Primer
(F):5'- CTGTGCGCAGGAACTACAGTTG -3'
(R):5'- ACCGACTATGGAGCGTCAG -3'
Posted On2016-06-21