Mutagenetix > Incidental Mutation

Incidental Mutation 'R5156:Apeh'

396736

Institutional Source

Beutler Lab

Gene Symbol

Apeh

Ensembl Gene

ENSMUSG00000032590

Gene Name

acylpeptide hydrolase

Synonyms

N-acylaminoacyl peptide hydrolase

MMRRC Submission

042738-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108085413-108094606 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108094287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 29 (A29T)

Ref Sequence

ENSEMBL: ENSMUSP00000141856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208] [ENSMUST00000191985] [ENSMUST00000193254]

AlphaFold

Q8R146

Predicted Effect

probably benign
Transcript: ENSMUST00000035208

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081309
AA Change: A27T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590
AA Change: A27T

Domain	Start	End	E-Value	Type
Pfam:DLH	485	721	2e-8	PFAM
Pfam:Abhydrolase_1	501	633	3.8e-9	PFAM
Pfam:Abhydrolase_5	501	708	5e-16	PFAM
Pfam:Peptidase_S9	516	732	1.6e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Predicted Effect

probably damaging
Transcript: ENSMUST00000191985
AA Change: A54T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142150
Gene: ENSMUSG00000032590
AA Change: A54T

Domain	Start	End	E-Value	Type
low complexity region	3	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192278

Predicted Effect

probably damaging
Transcript: ENSMUST00000193254
AA Change: A29T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590
AA Change: A29T

Domain	Start	End	E-Value	Type
Pfam:DLH	485	721	4.8e-8	PFAM
Pfam:Abhydrolase_5	501	708	5.7e-16	PFAM
Pfam:Abhydrolase_6	503	714	6.2e-14	PFAM
Pfam:Peptidase_S9	515	732	1.4e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194915

Meta Mutation Damage Score

0.3566

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Apeh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01317:Apeh	APN	9	108086207	missense	probably benign
IGL02232:Apeh	APN	9	108091872	missense	probably benign	0.02
IGL02563:Apeh	APN	9	108093709	missense	possibly damaging	0.85
IGL02713:Apeh	APN	9	108085672	missense	probably damaging	1.00
IGL02794:Apeh	APN	9	108092010	missense	possibly damaging	0.94
IGL03355:Apeh	APN	9	108086445	missense	probably benign	0.00
R6807_Apeh_606	UTSW	9	108092679	missense	probably damaging	1.00
R0511:Apeh	UTSW	9	108087055	missense	probably benign
R1221:Apeh	UTSW	9	108092609	missense	probably benign
R1574:Apeh	UTSW	9	108092726	splice site	probably null
R1863:Apeh	UTSW	9	108092103	missense	possibly damaging	0.91
R2126:Apeh	UTSW	9	108085667	missense	probably damaging	1.00
R2353:Apeh	UTSW	9	108086292	missense	possibly damaging	0.84
R4930:Apeh	UTSW	9	108087825	missense	probably benign
R5278:Apeh	UTSW	9	108091258	missense	probably benign	0.08
R5366:Apeh	UTSW	9	108091806	missense	probably benign	0.01
R5384:Apeh	UTSW	9	108086463	missense	probably damaging	1.00
R5940:Apeh	UTSW	9	108091899	splice site	probably null
R6102:Apeh	UTSW	9	108086439	missense	probably damaging	1.00
R6300:Apeh	UTSW	9	108092679	missense	probably damaging	1.00
R6368:Apeh	UTSW	9	108087243	missense	probably damaging	1.00
R6807:Apeh	UTSW	9	108092679	missense	probably damaging	1.00
R6809:Apeh	UTSW	9	108092679	missense	probably damaging	1.00
R6817:Apeh	UTSW	9	108092679	missense	probably damaging	1.00
R6828:Apeh	UTSW	9	108087038	missense	probably damaging	1.00
R6866:Apeh	UTSW	9	108092679	missense	probably damaging	1.00
R7034:Apeh	UTSW	9	108094271	missense	possibly damaging	0.70
R7036:Apeh	UTSW	9	108094271	missense	possibly damaging	0.70
R7139:Apeh	UTSW	9	108092146	missense	probably damaging	1.00
R8024:Apeh	UTSW	9	108092591	missense	probably benign	0.20
R8289:Apeh	UTSW	9	108086245	missense	probably damaging	0.99
R8731:Apeh	UTSW	9	108087223	missense	probably benign
R8957:Apeh	UTSW	9	108092373	missense	probably benign	0.21
R9055:Apeh	UTSW	9	108085846	missense	possibly damaging	0.64
R9569:Apeh	UTSW	9	108094410	missense	unknown
R9695:Apeh	UTSW	9	108086284	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACACCTTCAACTCATTTACGG -3'
(R):5'- CGAAAGACCGACTATGGAGC -3'

Sequencing Primer
(F):5'- CTGTGCGCAGGAACTACAGTTG -3'
(R):5'- ACCGACTATGGAGCGTCAG -3'

Posted On

2016-06-21