Incidental Mutation 'R5156:Ikzf1'
ID396739
Institutional Source Beutler Lab
Gene Symbol Ikzf1
Ensembl Gene ENSMUSG00000018654
Gene NameIKAROS family zinc finger 1
SynonymsLyF-1, 5832432G11Rik, Zfpn1a1, Ikaros
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location11685003-11772926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11769448 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 492 (M492K)
Ref Sequence ENSEMBL: ENSMUSP00000067372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018798] [ENSMUST00000065433] [ENSMUST00000076700]
Predicted Effect probably damaging
Transcript: ENSMUST00000018798
AA Change: M385K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018798
Gene: ENSMUSG00000018654
AA Change: M385K

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
low complexity region 282 293 N/A INTRINSIC
ZnF_C2H2 371 393 7.49e0 SMART
ZnF_C2H2 399 423 5.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065433
AA Change: M492K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067372
Gene: ENSMUSG00000018654
AA Change: M492K

DomainStartEndE-ValueType
ZnF_C2H2 137 159 1.43e-1 SMART
ZnF_C2H2 165 187 8.02e-5 SMART
ZnF_C2H2 193 215 2.57e-3 SMART
ZnF_C2H2 221 244 8.22e-2 SMART
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 5.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076700
AA Change: M472K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075992
Gene: ENSMUSG00000018654
AA Change: M472K

DomainStartEndE-ValueType
ZnF_C2H2 117 139 1.43e-1 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 2.57e-3 SMART
ZnF_C2H2 201 224 8.22e-2 SMART
low complexity region 369 380 N/A INTRINSIC
ZnF_C2H2 458 480 7.49e0 SMART
ZnF_C2H2 486 510 5.34e-1 SMART
Meta Mutation Damage Score 0.9625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Ikzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Ikzf1 APN 11 11768923 missense probably damaging 1.00
IGL01367:Ikzf1 APN 11 11748358 missense probably benign 0.04
IGL01823:Ikzf1 APN 11 11769091 missense possibly damaging 0.64
IGL02342:Ikzf1 APN 11 11700216 utr 5 prime probably benign
IGL02452:Ikzf1 APN 11 11748545 missense probably damaging 1.00
IGL03209:Ikzf1 APN 11 11700226 missense probably benign
IGL03236:Ikzf1 APN 11 11707848 missense probably damaging 1.00
Herrscher UTSW 11 11768961 nonsense probably null
Star_lord UTSW 11 11769448 missense probably damaging 1.00
waxwing UTSW 11 11748464 nonsense probably null
R0133:Ikzf1 UTSW 11 11741015 splice site probably null
R0417:Ikzf1 UTSW 11 11769352 missense probably benign 0.19
R0633:Ikzf1 UTSW 11 11769223 missense probably damaging 1.00
R0734:Ikzf1 UTSW 11 11758195 missense probably damaging 1.00
R1693:Ikzf1 UTSW 11 11707838 missense probably damaging 1.00
R2114:Ikzf1 UTSW 11 11769473 missense probably damaging 1.00
R2927:Ikzf1 UTSW 11 11769324 missense probably damaging 1.00
R4250:Ikzf1 UTSW 11 11754166 missense probably damaging 1.00
R5912:Ikzf1 UTSW 11 11748464 nonsense probably null
R6274:Ikzf1 UTSW 11 11768961 nonsense probably null
R7614:Ikzf1 UTSW 11 11769019 missense probably damaging 1.00
R7727:Ikzf1 UTSW 11 11748339 missense probably damaging 1.00
R7759:Ikzf1 UTSW 11 11769256 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCGGCCTTATCTACCTAACC -3'
(R):5'- AACATTGTCCGCTGTGGGTC -3'

Sequencing Primer
(F):5'- GGCCTTATCTACCTAACCAACCAC -3'
(R):5'- AGGAGGCATAACCAGCTATCTTTGTG -3'
Posted On2016-06-21