Mutagenetix > Incidental Mutations

Incidental Mutation 'R0452:Mgam'

39674

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

038652-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R0452 (G1)

Quality Score

136

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40759090 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 841 (Y841C)

Ref Sequence

ENSEMBL: ENSMUSP00000144680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071535
AA Change: Y1587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: Y1587C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201148
AA Change: Y1587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: Y1587C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202775

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: Y960C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: Y960C

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202966
AA Change: Y841C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: Y841C

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.8685

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.7%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030452D12Rik	A	G	8: 106,507,190		probably benign	Het
Acap3	C	A	4: 155,902,328	S347*	probably null	Het
Acvr1	G	A	2: 58,500,495	P19L	probably benign	Het
Add2	G	T	6: 86,104,629	E366*	probably null	Het
Ankrd28	C	A	14: 31,748,738	A153S	probably damaging	Het
Anxa8	A	T	14: 34,094,770	I206F	probably damaging	Het
Arhgef4	G	A	1: 34,732,322	E1237K	probably damaging	Het
Arid1a	C	T	4: 133,689,105	A1120T	unknown	Het
Atad5	T	C	11: 80,106,421	V857A	probably damaging	Het
Atp2a3	T	A	11: 72,977,232		probably null	Het
Atxn1l	C	T	8: 109,732,395	V412I	possibly damaging	Het
Card11	A	G	5: 140,880,370	S923P	probably benign	Het
Cars	C	A	7: 143,592,625	E21*	probably null	Het
Ccdc115	A	G	1: 34,437,621		probably benign	Het
Ccnj	T	A	19: 40,845,064		probably null	Het
Cds2	C	T	2: 132,298,479	T182I	probably damaging	Het
Ceacam14	A	G	7: 17,815,323	H213R	probably benign	Het
Cfap44	A	T	16: 44,431,945	M806L	probably benign	Het
Chd8	A	T	14: 52,214,587	I1317K	probably damaging	Het
Cherp	A	T	8: 72,461,522		probably benign	Het
Creb5	C	G	6: 53,604,542	T30S	possibly damaging	Het
Csf2ra	A	G	19: 61,226,895	M94T	probably benign	Het
Cyp2b19	A	C	7: 26,766,762	D330A	probably benign	Het
Ddost	G	A	4: 138,310,188	V188M	possibly damaging	Het
Dnah7a	A	T	1: 53,605,819	D1019E	probably benign	Het
Dtx1	A	T	5: 120,694,992	I127N	possibly damaging	Het
Dyrk2	T	C	10: 118,868,763	T3A	possibly damaging	Het
Elovl5	C	T	9: 77,960,911	T35M	probably damaging	Het
Emc7	T	C	2: 112,466,969		probably benign	Het
Erp27	T	C	6: 136,909,489	Y182C	probably damaging	Het
Exoc2	T	A	13: 30,886,327		probably benign	Het
F5	A	C	1: 164,185,107	D530A	probably damaging	Het
Fam149a	A	T	8: 45,355,649	V149E	probably damaging	Het
Fbxo41	A	G	6: 85,478,182	S614P	probably damaging	Het
Fmn1	T	A	2: 113,636,779	Y1342N	possibly damaging	Het
Gm10334	A	G	6: 41,445,337	Y45H	probably benign	Het
Gpr22	T	A	12: 31,708,794	D443V	possibly damaging	Het
Il17rd	T	A	14: 27,091,931	W56R	probably damaging	Het
Itga2b	A	T	11: 102,465,953		probably null	Het
Jmjd1c	T	C	10: 67,255,482	M2514T	probably benign	Het
Klk9	T	C	7: 43,794,251		probably benign	Het
Krr1	T	C	10: 111,975,598	Y66H	probably damaging	Het
Lamb2	T	C	9: 108,486,354		probably benign	Het
Lgals3bp	A	T	11: 118,393,464	Y430N	probably benign	Het
Lrp10	T	C	14: 54,467,579	V113A	probably benign	Het
Nisch	T	A	14: 31,177,464		probably benign	Het
Nlrp4d	G	A	7: 10,378,292	T650I	probably benign	Het
Olfr1314	T	A	2: 112,092,636	K22*	probably null	Het
Olfr506	C	T	7: 108,612,370	T21I	possibly damaging	Het
Parp4	A	G	14: 56,648,843	D1793G	unknown	Het
Pcm1	A	G	8: 41,325,905	D1850G	probably benign	Het
Pgap2	G	A	7: 102,236,462	A145T	probably damaging	Het
Phc1	G	A	6: 122,323,036	A583V	probably damaging	Het
Plcd3	G	A	11: 103,071,259		probably benign	Het
Ppm1m	T	A	9: 106,197,302	Q214L	probably damaging	Het
Prkg2	A	G	5: 98,997,520		probably benign	Het
Rasal3	T	C	17: 32,395,817		probably benign	Het
Rfc1	A	T	5: 65,264,297	D1086E	probably benign	Het
Rnf145	T	A	11: 44,561,760	L522H	probably damaging	Het
Setd2	T	A	9: 110,553,100		probably null	Het
Sik1	C	A	17: 31,849,081	V377F	possibly damaging	Het
Slc44a4	T	C	17: 34,928,095	I367T	possibly damaging	Het
Slfn3	A	G	11: 83,213,128	D275G	possibly damaging	Het
Smarcad1	A	T	6: 65,074,822	N313I	possibly damaging	Het
Smc4	A	T	3: 69,008,028	K138*	probably null	Het
Smg6	T	A	11: 74,930,213	S437T	probably benign	Het
Spaca9	G	T	2: 28,695,993	Q20K	probably damaging	Het
Spatc1	T	G	15: 76,268,293	I41S	probably damaging	Het
Spink5	A	T	18: 43,963,318	T5S	possibly damaging	Het
St3gal1	C	A	15: 67,109,655		probably benign	Het
Stat5a	C	A	11: 100,863,135	T97K	probably benign	Het
Stat5b	A	T	11: 100,798,330	I246N	probably benign	Het
Supt6	G	T	11: 78,227,003	D462E	probably damaging	Het
Swi5	A	T	2: 32,281,824		probably benign	Het
Syne1	A	T	10: 5,405,435	V375E	probably damaging	Het
Tcp1	T	C	17: 12,924,352	F516S	probably benign	Het
Tdrd7	A	T	4: 45,965,488		probably benign	Het
Tgfbr3	A	T	5: 107,140,423	N457K	probably benign	Het
Tmem209	A	G	6: 30,487,381	M500T	probably damaging	Het
Tmem44	C	T	16: 30,517,463		probably benign	Het
Ttc21a	T	A	9: 119,939,154		probably benign	Het
Ttn	T	A	2: 76,836,003	I88F	possibly damaging	Het
Ttn	A	G	2: 76,871,110		probably benign	Het
Ube2w	T	C	1: 16,602,255		probably benign	Het
Ufc1	C	T	1: 171,289,954		probably benign	Het
Uhmk1	A	G	1: 170,212,402	M132T	possibly damaging	Het
Usp29	A	G	7: 6,963,182	N675D	possibly damaging	Het
Vmn1r23	A	G	6: 57,926,484	V103A	possibly damaging	Het
Wdr59	G	T	8: 111,521,972	R4S	possibly damaging	Het
Zc3hav1	T	A	6: 38,307,437	E914D	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGTTGCAGAGAAATTAGCTTTCAGTG -3'
(R):5'- AGATAAGACGGTTTCCGCATGTCC -3'

Sequencing Primer
(F):5'- CAGTGACCTTTAAGTCCCTTGAGAG -3'
(R):5'- GCCAGGATTCCTGCTTAACA -3'

Posted On

2013-05-23