Incidental Mutation 'R5156:Tnfsf12'
ID396742
Institutional Source Beutler Lab
Gene Symbol Tnfsf12
Ensembl Gene ENSMUSG00000097328
Gene Nametumor necrosis factor (ligand) superfamily, member 12
SynonymsAPO3L, DR3L, Tweak
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69686250-69695849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69687329 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 141 (S141P)
Ref Sequence ENSEMBL: ENSMUSP00000137972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018896] [ENSMUST00000108648] [ENSMUST00000108649] [ENSMUST00000174159] [ENSMUST00000180587] [ENSMUST00000181261] [ENSMUST00000181810]
Predicted Effect probably benign
Transcript: ENSMUST00000018896
SMART Domains Protein: ENSMUSP00000018896
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
low complexity region 101 106 N/A INTRINSIC
TNF 107 240 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108648
SMART Domains Protein: ENSMUSP00000104288
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
TNF 97 224 6.21e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108649
AA Change: S141P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104289
Gene: ENSMUSG00000018752
AA Change: S141P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
PDB:4HT1|T 110 166 1e-31 PDB
Blast:TNF 117 166 4e-27 BLAST
low complexity region 190 195 N/A INTRINSIC
TNF 196 329 7.41e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145435
Predicted Effect probably damaging
Transcript: ENSMUST00000174159
AA Change: S141P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133951
Gene: ENSMUSG00000018752
AA Change: S141P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 255 6.18e-10 SMART
low complexity region 269 274 N/A INTRINSIC
TNF 275 408 7.41e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180587
AA Change: S142P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137973
Gene: ENSMUSG00000018752
AA Change: S142P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
TNF 118 256 6.18e-10 SMART
low complexity region 270 275 N/A INTRINSIC
TNF 276 410 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181261
SMART Domains Protein: ENSMUSP00000137916
Gene: ENSMUSG00000097328

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
Blast:TNF 72 98 8e-8 BLAST
PDB:4HT1|T 72 98 1e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000181810
AA Change: S141P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137972
Gene: ENSMUSG00000097328
AA Change: S141P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 248 3.67e-35 SMART
Meta Mutation Damage Score 0.6632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased numbers of natural killer cells, particulalry in secondary lymph organs. They display an enhanced inflammatory response, increased susceptibility to lipopolysaccharide, and increased tumor resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Tnfsf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4519001:Tnfsf12 UTSW 11 69695404 missense probably benign 0.00
R2100:Tnfsf12 UTSW 11 69687349 missense probably damaging 1.00
R5849:Tnfsf12 UTSW 11 69686967 missense probably damaging 0.97
R7383:Tnfsf12 UTSW 11 69687066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCATCTTCCTTCATG -3'
(R):5'- CCACCTATACTCTGGGCAAG -3'

Sequencing Primer
(F):5'- TTCCTTCATGAGTCGCAGAG -3'
(R):5'- ATACTCTGGGCAAGCTGTAC -3'
Posted On2016-06-21