Incidental Mutation 'R5156:Krt20'
ID 396743
Institutional Source Beutler Lab
Gene Symbol Krt20
Ensembl Gene ENSMUSG00000035775
Gene Name keratin 20
Synonyms CK20, 9030623C06Rik, cytokeratin 20
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5156 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99428403-99438150 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 99430053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 394 (S394R)
Ref Sequence ENSEMBL: ENSMUSP00000017743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017743]
AlphaFold Q9D312
Predicted Effect possibly damaging
Transcript: ENSMUST00000017743
AA Change: S394R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017743
Gene: ENSMUSG00000035775
AA Change: S394R

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Filament 76 387 7.19e-146 SMART
low complexity region 410 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128904
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a member of the keratin protein family and is found within a cluster of cytokeratin genes on chromosome 11. Keratins are cytoskeletal proteins that are preferentially expressed in epithelial cells. The encoded protein may help maintain intermediate filament organization in intestinal epithelium. Phosphorylation of this protein may also influence mucin secretion in the small intestine. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Efemp2 T A 19: 5,477,678 C94S possibly damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Krt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Krt20 APN 11 99431943 missense probably benign 0.01
IGL01926:Krt20 APN 11 99437826 missense probably damaging 1.00
IGL02105:Krt20 APN 11 99438001 missense probably benign 0.01
IGL03225:Krt20 APN 11 99431930 missense probably damaging 0.97
IGL03274:Krt20 APN 11 99430029 splice site probably benign
IGL03331:Krt20 APN 11 99435430 splice site probably null
R0091:Krt20 UTSW 11 99437814 missense probably damaging 1.00
R0446:Krt20 UTSW 11 99437776 nonsense probably null
R3955:Krt20 UTSW 11 99432211 nonsense probably null
R4805:Krt20 UTSW 11 99428985 missense unknown
R5620:Krt20 UTSW 11 99435457 missense probably damaging 1.00
R6716:Krt20 UTSW 11 99431928 missense possibly damaging 0.77
R7006:Krt20 UTSW 11 99437761 missense probably benign 0.34
R8041:Krt20 UTSW 11 99437837 missense probably damaging 1.00
R8296:Krt20 UTSW 11 99432237 missense probably damaging 1.00
R9189:Krt20 UTSW 11 99432261 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCATGAAGTTGTCCTCTGACTTC -3'
(R):5'- AGGCTGGTGTTTTCCAAGCC -3'

Sequencing Primer
(F):5'- CATGGTGGCATGGACATTCTCTC -3'
(R):5'- GCTGGTGTTTTCCAAGCCAAAAAG -3'
Posted On 2016-06-21