Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Krt20'

396743

Institutional Source

Beutler Lab

Gene Symbol

Krt20

Ensembl Gene

ENSMUSG00000035775

Gene Name

keratin 20

Synonyms

CK20, 9030623C06Rik, cytokeratin 20

MMRRC Submission

042738-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99428403-99438150 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 99430053 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 394 (S394R)

Ref Sequence

ENSEMBL: ENSMUSP00000017743 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017743]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000017743
AA Change: S394R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000017743
Gene: ENSMUSG00000035775
AA Change: S394R

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Filament	76	387	7.19e-146	SMART
low complexity region	410	431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128904

Meta Mutation Damage Score

0.0857

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: This gene encodes a member of the keratin protein family and is found within a cluster of cytokeratin genes on chromosome 11. Keratins are cytoskeletal proteins that are preferentially expressed in epithelial cells. The encoded protein may help maintain intermediate filament organization in intestinal epithelium. Phosphorylation of this protein may also influence mucin secretion in the small intestine. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Krt20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01455:Krt20	APN	11	99431943	missense	probably benign	0.01
IGL01926:Krt20	APN	11	99437826	missense	probably damaging	1.00
IGL02105:Krt20	APN	11	99438001	missense	probably benign	0.01
IGL03225:Krt20	APN	11	99431930	missense	probably damaging	0.97
IGL03274:Krt20	APN	11	99430029	splice site	probably benign
IGL03331:Krt20	APN	11	99435430	splice site	probably null
R0091:Krt20	UTSW	11	99437814	missense	probably damaging	1.00
R0446:Krt20	UTSW	11	99437776	nonsense	probably null
R3955:Krt20	UTSW	11	99432211	nonsense	probably null
R4805:Krt20	UTSW	11	99428985	missense	unknown
R5620:Krt20	UTSW	11	99435457	missense	probably damaging	1.00
R6716:Krt20	UTSW	11	99431928	missense	possibly damaging	0.77
R7006:Krt20	UTSW	11	99437761	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- GCATGAAGTTGTCCTCTGACTTC -3'
(R):5'- AGGCTGGTGTTTTCCAAGCC -3'

Sequencing Primer
(F):5'- CATGGTGGCATGGACATTCTCTC -3'
(R):5'- GCTGGTGTTTTCCAAGCCAAAAAG -3'

Posted On

2016-06-21