Mutagenetix > Incidental Mutation

Incidental Mutation 'R5156:Ttc23l'

396748

Institutional Source

Beutler Lab

Gene Symbol

Ttc23l

Ensembl Gene

ENSMUSG00000022249

Gene Name

tetratricopeptide repeat domain 23-like

Synonyms

4930401A09Rik

MMRRC Submission

042738-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10500102-10558668 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10551550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 30 (T30K)

Ref Sequence

ENSEMBL: ENSMUSP00000022857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]

AlphaFold

A6H6E9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
TPR	159	192	4.21e1	SMART
Blast:TPR	208	239	2e-6	BLAST
TPR	250	283	1.4e1	SMART
low complexity region	292	303	N/A	INTRINSIC
TPR	376	409	9.53e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166039

SMART Domains

Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

Domain	Start	End	E-Value	Type
Blast:TPR	183	209	9e-11	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:TPR_1	102	133	3.3e-6	PFAM
low complexity region	148	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Muc19	T	A	15: 91,900,420		noncoding transcript	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Ttc23l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ttc23l	APN	15	10530689	missense	probably damaging	1.00
IGL01319:Ttc23l	APN	15	10509406	splice site	probably benign
IGL01562:Ttc23l	APN	15	10551390	splice site	probably benign
IGL01969:Ttc23l	APN	15	10551434	nonsense	probably null
IGL03172:Ttc23l	APN	15	10537566	missense	probably benign	0.06
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0335:Ttc23l	UTSW	15	10539963	missense	probably benign	0.26
R0554:Ttc23l	UTSW	15	10530657	missense	probably benign	0.12
R0609:Ttc23l	UTSW	15	10504536	missense	probably benign
R0631:Ttc23l	UTSW	15	10539980	missense	probably damaging	1.00
R1703:Ttc23l	UTSW	15	10523658	missense	probably damaging	1.00
R2106:Ttc23l	UTSW	15	10547256	missense	probably damaging	1.00
R2220:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2276:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2277:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2278:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2279:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2368:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2368:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2420:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2420:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2421:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2422:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2422:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2830:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2979:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2980:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2980:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2981:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2981:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2982:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2982:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2983:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2983:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3176:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3177:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3276:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3277:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3722:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3722:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3743:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3743:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3767:Ttc23l	UTSW	15	10530695	missense	possibly damaging	0.94
R3921:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537563	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4091:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4091:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4119:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4120:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4373:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4373:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4375:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4375:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4376:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4377:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4377:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R5002:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5106:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5107:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5109:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5157:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5160:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5161:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5259:Ttc23l	UTSW	15	10515150	missense	probably damaging	0.99
R5307:Ttc23l	UTSW	15	10533659	missense	probably damaging	1.00
R5728:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5756:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5772:Ttc23l	UTSW	15	10551469	missense	probably benign	0.01
R5793:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5794:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5847:Ttc23l	UTSW	15	10537596	missense	probably benign	0.07
R6976:Ttc23l	UTSW	15	10537580	nonsense	probably null
R7010:Ttc23l	UTSW	15	10515138	missense	probably damaging	1.00
R7342:Ttc23l	UTSW	15	10551497	missense	probably benign	0.01
R7404:Ttc23l	UTSW	15	10551577	missense	probably damaging	0.98
R7453:Ttc23l	UTSW	15	10533767	missense	probably damaging	1.00
R7584:Ttc23l	UTSW	15	10533708	missense	probably damaging	1.00
R7599:Ttc23l	UTSW	15	10533680	missense	possibly damaging	0.89
R8710:Ttc23l	UTSW	15	10539935	missense	probably damaging	1.00
R8927:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R8928:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R9101:Ttc23l	UTSW	15	10537575	missense	probably benign	0.16
R9746:Ttc23l	UTSW	15	10523643	missense	probably benign	0.01
R9782:Ttc23l	UTSW	15	10530681	missense	probably damaging	1.00
R9792:Ttc23l	UTSW	15	10537645	missense	probably benign
R9793:Ttc23l	UTSW	15	10537645	missense	probably benign
R9795:Ttc23l	UTSW	15	10537645	missense	probably benign
Z1088:Ttc23l	UTSW	15	10533667	missense	probably damaging	1.00
Z1177:Ttc23l	UTSW	15	10533633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGCTTTCAAATGACAACCTG -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAACCC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'

Posted On

2016-06-21