Mutagenetix > Incidental Mutations

Incidental Mutation 'R5156:Muc19'

396750

Institutional Source

Beutler Lab

Gene Symbol

Muc19

Ensembl Gene

ENSMUSG00000044021

Gene Name

mucin 19

Synonyms

apomucin, sld

MMRRC Submission

042738-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R5156 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91838326-91934555 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 91900420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160242

SMART Domains

Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	21	34	N/A	INTRINSIC
VWD	47	198	1.31e-13	SMART
Pfam:C8	221	293	1.1e-8	PFAM
Pfam:TIL	298	353	1.6e-11	PFAM
VWD	383	545	1.58e-25	SMART
C8	577	651	8.71e-20	SMART
Pfam:TIL	654	711	2.1e-7	PFAM
Pfam:TIL	753	813	5.2e-8	PFAM
VWD	842	1005	2.36e-47	SMART
C8	1041	1115	1.84e-27	SMART
low complexity region	1220	1254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180042

SMART Domains

Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
C8	17	91	8.71e-20	SMART
Pfam:TIL	94	151	1.2e-7	PFAM
Pfam:TIL	193	253	6.6e-8	PFAM
VWD	282	445	2.36e-47	SMART
C8	481	555	1.84e-27	SMART
low complexity region	660	701	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,593,424		probably null	Het
4921513D11Rik	G	T	17: 79,628,209		probably benign	Het
Apeh	C	T	9: 108,094,287	A29T	probably damaging	Het
Arap2	A	T	5: 62,669,181	Y1013*	probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Asf1b	T	C	8: 83,955,911	F28S	probably damaging	Het
Cd46	T	A	1: 195,085,385	I123L	possibly damaging	Het
Cdca7	A	T	2: 72,479,026	T48S	probably damaging	Het
Cfap53	T	A	18: 74,359,767		probably benign	Het
Clca3a2	T	A	3: 144,805,838	T599S	probably benign	Het
Csf1	T	A	3: 107,748,936	T148S	probably benign	Het
Dmbt1	T	C	7: 131,097,670		probably null	Het
Dmpk	A	G	7: 19,084,125	D44G	probably damaging	Het
Dnajb12	T	A	10: 59,892,960	N223K	probably damaging	Het
Dync1h1	T	A	12: 110,628,830	M1392K	probably benign	Het
Edrf1	C	T	7: 133,660,179	A867V	probably damaging	Het
Efemp2	T	A	19: 5,477,678	C94S	possibly damaging	Het
Epha8	C	T	4: 136,938,726	S373N	probably benign	Het
Foxk1	A	G	5: 142,448,833	D284G	possibly damaging	Het
Fzd10	C	A	5: 128,601,302	R29S	possibly damaging	Het
Gm13991	T	C	2: 116,528,184		noncoding transcript	Het
Gm6818	A	T	7: 38,402,047		noncoding transcript	Het
Hydin	T	A	8: 110,609,701	C5037S	probably benign	Het
Ikzf1	T	A	11: 11,769,448	M492K	probably damaging	Het
Krt20	G	T	11: 99,430,053	S394R	possibly damaging	Het
Lrrc71	T	A	3: 87,745,787	R107S	probably benign	Het
Mia2	A	G	12: 59,172,537	T436A	possibly damaging	Het
Neu4	T	C	1: 94,024,455	V182A	probably damaging	Het
Notch2	T	G	3: 98,124,310	F1167V	possibly damaging	Het
Nrap	A	G	19: 56,371,845	M189T	possibly damaging	Het
Nt5m	A	T	11: 59,874,661	I172F	probably damaging	Het
Olfr1138	G	A	2: 87,737,775	P183L	possibly damaging	Het
Olfr1474	G	T	19: 13,471,673	K234N	probably damaging	Het
Olfr228	A	T	2: 86,483,018	C241*	probably null	Het
Plekha5	C	T	6: 140,426,528	T68M	probably damaging	Het
Ppef2	A	G	5: 92,244,602		probably null	Het
Ppp1r37	T	C	7: 19,561,975		probably benign	Het
Rfx4	T	C	10: 84,868,354	Y238H	probably damaging	Het
Sec13	G	A	6: 113,730,876	A161V	probably benign	Het
Serhl	G	A	15: 83,102,694		probably benign	Het
Slco4a1	T	C	2: 180,472,779	V588A	probably benign	Het
Slitrk3	T	C	3: 73,049,259	T727A	probably benign	Het
Sp100	T	A	1: 85,673,683	D241E	probably damaging	Het
Spata2	G	T	2: 167,483,574	H442N	probably damaging	Het
Speg	T	C	1: 75,428,087	V2588A	probably damaging	Het
Tnfsf12	A	G	11: 69,687,329	S141P	probably damaging	Het
Trank1	A	G	9: 111,390,694	I2166M	probably damaging	Het
Trim10	T	A	17: 36,877,056	V388E	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r10	A	G	5: 108,995,600	V828A	probably benign	Het
Vmn2r75	T	A	7: 86,164,228	L455F	possibly damaging	Het
Vwa8	T	A	14: 78,984,226	S541T	probably benign	Het

Other mutations in Muc19

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00985:Muc19	APN	15	91886749	exon	noncoding transcript
IGL01017:Muc19	APN	15	91880707	exon	noncoding transcript
IGL01140:Muc19	APN	15	91899399	exon	noncoding transcript
IGL01292:Muc19	APN	15	91894276	exon	noncoding transcript
IGL01397:Muc19	APN	15	91894304	exon	noncoding transcript
IGL01525:Muc19	APN	15	91886683	exon	noncoding transcript
IGL01589:Muc19	APN	15	91870501	exon	noncoding transcript
IGL02023:Muc19	APN	15	91888259	exon	noncoding transcript
IGL02088:Muc19	APN	15	91891168	splice site	noncoding transcript
IGL02168:Muc19	APN	15	91894098	exon	noncoding transcript
IGL02343:Muc19	APN	15	91894234	exon	noncoding transcript
IGL02402:Muc19	APN	15	91893998	splice site	noncoding transcript
IGL02433:Muc19	APN	15	91872496	exon	noncoding transcript
IGL02533:Muc19	APN	15	91898047	exon	noncoding transcript
IGL02558:Muc19	APN	15	91897622	exon	noncoding transcript
IGL02652:Muc19	APN	15	91877815	critical splice donor site	noncoding transcript
IGL03032:Muc19	APN	15	91910539	unclassified	noncoding transcript
IGL02837:Muc19	UTSW	15	91882656	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0208:Muc19	UTSW	15	91893024	splice site	noncoding transcript
R0597:Muc19	UTSW	15	91900502	splice site	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1469:Muc19	UTSW	15	91874300	unclassified	noncoding transcript
R1942:Muc19	UTSW	15	91892472	exon	noncoding transcript
R2035:Muc19	UTSW	15	91892405	splice site	noncoding transcript
R2208:Muc19	UTSW	15	91871549	exon	noncoding transcript
R2877:Muc19	UTSW	15	91893006	exon	noncoding transcript
R2897:Muc19	UTSW	15	91924665	critical splice donor site	noncoding transcript
R4110:Muc19	UTSW	15	91897622	exon	noncoding transcript
R4403:Muc19	UTSW	15	91871570	exon	noncoding transcript
R4606:Muc19	UTSW	15	91934383	exon	noncoding transcript
R4677:Muc19	UTSW	15	91888217	exon	noncoding transcript
R4753:Muc19	UTSW	15	91877761	unclassified	noncoding transcript
R4781:Muc19	UTSW	15	91903166	critical splice donor site	noncoding transcript
R4869:Muc19	UTSW	15	91897716	exon	noncoding transcript
R5000:Muc19	UTSW	15	91873231	unclassified	noncoding transcript
R5044:Muc19	UTSW	15	91888138	exon	noncoding transcript
R5176:Muc19	UTSW	15	91892180	exon	noncoding transcript
R5224:Muc19	UTSW	15	91928025	exon	noncoding transcript
R5524:Muc19	UTSW	15	91894393	exon	noncoding transcript
R5568:Muc19	UTSW	15	91884274	splice site	noncoding transcript
R5592:Muc19	UTSW	15	91930314	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GTGATGTCTTGCTACACTCCAC -3'
(R):5'- CATCATCGAAAGCCTGCAAG -3'

Sequencing Primer
(F):5'- CCTCAGCTAACAGAATTATTGCAG -3'
(R):5'- AGTAGCACAGAGCATACC -3'

Posted On

2016-06-21