Incidental Mutation 'R5156:Efemp2'
ID396754
Institutional Source Beutler Lab
Gene Symbol Efemp2
Ensembl Gene ENSMUSG00000024909
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 2
SynonymsMBP1, fibulin-4, Fbln4, 0610011K11Rik, fibulin 4
MMRRC Submission 042738-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5156 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5473973-5481853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5477678 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 94 (C94S)
Ref Sequence ENSEMBL: ENSMUSP00000132194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070118] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000166303] [ENSMUST00000167304] [ENSMUST00000167371] [ENSMUST00000167827] [ENSMUST00000167855] [ENSMUST00000168330] [ENSMUST00000169943]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070118
AA Change: C181S

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909
AA Change: C181S

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133436
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164388
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165485
AA Change: C162S

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909
AA Change: C162S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166253
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166303
SMART Domains Protein: ENSMUSP00000128827
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166558
Predicted Effect probably benign
Transcript: ENSMUST00000167304
SMART Domains Protein: ENSMUSP00000129982
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EGF_CA 54 86 2.4e-9 PFAM
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167371
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167827
AA Change: C94S

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127478
Gene: ENSMUSG00000024909
AA Change: C94S

DomainStartEndE-ValueType
Blast:EGF_like 1 26 9e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
EGF_CA 135 174 1.36e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167855
AA Change: C94S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132194
Gene: ENSMUSG00000024909
AA Change: C94S

DomainStartEndE-ValueType
Blast:EGF_like 1 26 4e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167920
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000169943
SMART Domains Protein: ENSMUSP00000126477
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Meta Mutation Damage Score 0.9660 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality with abnormal artery and lung morphology and defects in vascular, pulmonary, and hypodermal elastic fibers. Some alleles of Mus81 also affect expression of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,424 probably null Het
4921513D11Rik G T 17: 79,628,209 probably benign Het
Apeh C T 9: 108,094,287 A29T probably damaging Het
Arap2 A T 5: 62,669,181 Y1013* probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Asf1b T C 8: 83,955,911 F28S probably damaging Het
Cd46 T A 1: 195,085,385 I123L possibly damaging Het
Cdca7 A T 2: 72,479,026 T48S probably damaging Het
Cfap53 T A 18: 74,359,767 probably benign Het
Clca3a2 T A 3: 144,805,838 T599S probably benign Het
Csf1 T A 3: 107,748,936 T148S probably benign Het
Dmbt1 T C 7: 131,097,670 probably null Het
Dmpk A G 7: 19,084,125 D44G probably damaging Het
Dnajb12 T A 10: 59,892,960 N223K probably damaging Het
Dync1h1 T A 12: 110,628,830 M1392K probably benign Het
Edrf1 C T 7: 133,660,179 A867V probably damaging Het
Epha8 C T 4: 136,938,726 S373N probably benign Het
Foxk1 A G 5: 142,448,833 D284G possibly damaging Het
Fzd10 C A 5: 128,601,302 R29S possibly damaging Het
Gm13991 T C 2: 116,528,184 noncoding transcript Het
Gm6818 A T 7: 38,402,047 noncoding transcript Het
Hydin T A 8: 110,609,701 C5037S probably benign Het
Ikzf1 T A 11: 11,769,448 M492K probably damaging Het
Krt20 G T 11: 99,430,053 S394R possibly damaging Het
Lrrc71 T A 3: 87,745,787 R107S probably benign Het
Mia2 A G 12: 59,172,537 T436A possibly damaging Het
Muc19 T A 15: 91,900,420 noncoding transcript Het
Neu4 T C 1: 94,024,455 V182A probably damaging Het
Notch2 T G 3: 98,124,310 F1167V possibly damaging Het
Nrap A G 19: 56,371,845 M189T possibly damaging Het
Nt5m A T 11: 59,874,661 I172F probably damaging Het
Olfr1138 G A 2: 87,737,775 P183L possibly damaging Het
Olfr1474 G T 19: 13,471,673 K234N probably damaging Het
Olfr228 A T 2: 86,483,018 C241* probably null Het
Plekha5 C T 6: 140,426,528 T68M probably damaging Het
Ppef2 A G 5: 92,244,602 probably null Het
Ppp1r37 T C 7: 19,561,975 probably benign Het
Rfx4 T C 10: 84,868,354 Y238H probably damaging Het
Sec13 G A 6: 113,730,876 A161V probably benign Het
Serhl G A 15: 83,102,694 probably benign Het
Slco4a1 T C 2: 180,472,779 V588A probably benign Het
Slitrk3 T C 3: 73,049,259 T727A probably benign Het
Sp100 T A 1: 85,673,683 D241E probably damaging Het
Spata2 G T 2: 167,483,574 H442N probably damaging Het
Speg T C 1: 75,428,087 V2588A probably damaging Het
Tnfsf12 A G 11: 69,687,329 S141P probably damaging Het
Trank1 A G 9: 111,390,694 I2166M probably damaging Het
Trim10 T A 17: 36,877,056 V388E probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r10 A G 5: 108,995,600 V828A probably benign Het
Vmn2r75 T A 7: 86,164,228 L455F possibly damaging Het
Vwa8 T A 14: 78,984,226 S541T probably benign Het
Other mutations in Efemp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03011:Efemp2 APN 19 5480065 missense probably damaging 0.99
IGL03079:Efemp2 APN 19 5475127 missense probably damaging 1.00
H8562:Efemp2 UTSW 19 5480649 missense probably benign 0.43
R0149:Efemp2 UTSW 19 5477960 missense probably damaging 1.00
R0266:Efemp2 UTSW 19 5477999 missense probably damaging 1.00
R0594:Efemp2 UTSW 19 5475063 unclassified probably benign
R0723:Efemp2 UTSW 19 5480050 missense probably damaging 1.00
R2110:Efemp2 UTSW 19 5475162 missense probably damaging 1.00
R4307:Efemp2 UTSW 19 5481621 missense possibly damaging 0.82
R4494:Efemp2 UTSW 19 5480311 missense probably damaging 1.00
R4878:Efemp2 UTSW 19 5480761 unclassified probably benign
R4889:Efemp2 UTSW 19 5475120 missense probably null 1.00
R5165:Efemp2 UTSW 19 5475411 missense probably damaging 1.00
R6932:Efemp2 UTSW 19 5480245 missense probably damaging 1.00
R7171:Efemp2 UTSW 19 5480257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTGGTCAGGAGCATATGG -3'
(R):5'- ATGCTGGCAATAGCGGTAAC -3'

Sequencing Primer
(F):5'- AGGAGCATATGGGGGCCTC -3'
(R):5'- CGACACTCATCTATGTCTGAGATGG -3'
Posted On2016-06-21