Incidental Mutation 'R5157:Rfxap'
ID396767
Institutional Source Beutler Lab
Gene Symbol Rfxap
Ensembl Gene ENSMUSG00000036615
Gene Nameregulatory factor X-associated protein
Synonyms5730495K23Rik
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54803115-54807791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54804517 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 215 (N215I)
Ref Sequence ENSEMBL: ENSMUSP00000040917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371] [ENSMUST00000044373] [ENSMUST00000217267]
Predicted Effect probably benign
Transcript: ENSMUST00000029371
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044373
AA Change: N215I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040917
Gene: ENSMUSG00000036615
AA Change: N215I

DomainStartEndE-ValueType
low complexity region 42 65 N/A INTRINSIC
low complexity region 74 98 N/A INTRINSIC
Pfam:RFXA_RFXANK_bdg 100 226 6.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182246
Predicted Effect probably damaging
Transcript: ENSMUST00000217267
AA Change: N215I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated ankyrin-containing protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group D. Transcript variants utilizing different polyA signals have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Rfxap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1985:Rfxap UTSW 3 54807326 missense probably damaging 1.00
R6073:Rfxap UTSW 3 54807287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTCGCTTCAGTAGGCATAAC -3'
(R):5'- GCATTGCTGTGAGCTCAAAG -3'

Sequencing Primer
(F):5'- GACAGGAACTTGCTATGTAGCCC -3'
(R):5'- AAAGCCTGCCTGTCTATGG -3'
Posted On2016-06-21