Incidental Mutation 'R5157:Igsf21'
ID396771
Institutional Source Beutler Lab
Gene Symbol Igsf21
Ensembl Gene ENSMUSG00000040972
Gene Nameimmunoglobulin superfamily, member 21
SynonymsLOC230868
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5157 (G1)
Quality Score202
Status Validated
Chromosome4
Chromosomal Location140026846-140246784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140028067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 426 (T426A)
Ref Sequence ENSEMBL: ENSMUSP00000046558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039331
AA Change: T426A

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046558
Gene: ENSMUSG00000040972
AA Change: T426A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 141 1.93e-5 SMART
IG 348 431 2.38e0 SMART
Meta Mutation Damage Score 0.2255 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which has two immunoglobulin (Ig) domains and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal differentiation of inhibitory synapses with decreased mIPSC frequency and prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Igsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Igsf21 APN 4 140027718 splice site probably benign
IGL01613:Igsf21 APN 4 140107364 missense possibly damaging 0.75
IGL01618:Igsf21 APN 4 140107364 missense possibly damaging 0.75
R1458:Igsf21 UTSW 4 140028124 missense probably damaging 1.00
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1793:Igsf21 UTSW 4 140034392 missense probably damaging 1.00
R1913:Igsf21 UTSW 4 140107312 missense probably benign
R2220:Igsf21 UTSW 4 140028114 missense probably damaging 1.00
R4013:Igsf21 UTSW 4 140037469 missense possibly damaging 0.92
R4721:Igsf21 UTSW 4 140107310 missense probably benign 0.09
R4911:Igsf21 UTSW 4 140034623 missense probably benign 0.01
R5725:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R5778:Igsf21 UTSW 4 140037521 missense probably benign 0.28
R5804:Igsf21 UTSW 4 140028074 missense possibly damaging 0.70
R6140:Igsf21 UTSW 4 140107373 missense probably benign 0.10
R6778:Igsf21 UTSW 4 140034648 missense probably benign 0.05
R6888:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R6963:Igsf21 UTSW 4 140027730 missense probably benign 0.02
R7203:Igsf21 UTSW 4 140107337 missense possibly damaging 0.70
R7485:Igsf21 UTSW 4 140027738 missense probably benign 0.09
R7880:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
R7934:Igsf21 UTSW 4 140034444 missense possibly damaging 0.83
R8175:Igsf21 UTSW 4 140028231 missense probably damaging 1.00
Z1176:Igsf21 UTSW 4 140067215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACAATGGGATGGTACGACC -3'
(R):5'- AATGAGGTCTTCCCAGAACCC -3'

Sequencing Primer
(F):5'- TGGTACGACCATGTTACAAATAGG -3'
(R):5'- CATGTTCACGTGGACGAGAG -3'
Posted On2016-06-21